Structural insights into binding of STAC proteins to voltage-gated calcium channels.

Excitation-contraction (EC) coupling in skeletal muscle requires purposeful and mechanical coupling between L-type voltage-gated calcium channels (CaV1.1) and the ryanodine receptor (RyR1). Recently, STAC3 was recognized as an important protein for EC coupling and is an element of a gaggle of three proteins that may bind and modulate L-type voltage-gated calcium channels.

Here, we report crystal constructions of tandem-SH3 domains of completely different STAC isoforms up to 1.2-Å decision. These type a inflexible interplay by means of a conserved interdomain interface. We determine the linker connecting transmembrane repeats II and III in two completely different CaV isoforms as a binding website for the SH3 domains and report a crystal construction of the complicated with the STAC2 isoform.

The interplay website contains the placement for a illness variant in STAC3 that has been linked to Native American myopathy (NAM). Introducing the mutation doesn’t trigger misfolding of the SH3 domains, however abolishes the interplay. Disruption of the interplay through mutations within the II-III loop perturbs skeletal muscle EC coupling, however preserves the flexibility of STAC3 to decelerate inactivation of CaV1.2.

Calcium waves in a grid of clustered channels with synchronous IP3 binding and unbinding.

Calcium indicators in cells happen at a number of spatial scales and variable temporal length. However, a bodily rationalization for transitions between long-lasting international oscillations and localized short-term elevations (puffs) of cytoplasmic Ca2+ remains to be missing.

Here we introduce a phenomenological, coarse-grained mannequin for the calcium variable, which is represented by bizarre differential equations. Due to its small quantity of parameters, and its simplicity, this mannequin permits us to numerically research the interaction of multi-scale calcium concentrations with stochastic ion channel gating dynamics even in bigger techniques.

ANK1 siRNA
20-abx907484	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ANK1 cloning plasmid
CSB-CL001720HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 468 Sequence: atgtggactttcgtcacccagctgttggtcacgctggtgctgctgagcttcttcctggtcagctgtcagaacgtgatgcacattgtcagggggtccctgtgctttgtgctaaagcacatccaccaggagctggacaaggagctgggggagagcgaggacctcagtgacgacgagga Show more
Description: A cloning plasmid for the ANK1 gene.

ANK1 cloning plasmid
CSB-CL001720HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 396 Sequence: atgtggactttcgtcacccagctgttggtcacgctggtgctgctgagcttcttcctggtcagctgtcagaacgtgatgcacattgtcagggggtccctgtgctttgtgctaaagcacatccaccaggagctggacaaggagctgggggagagcgagggcctcagtgacgacgagga Show more
Description: A cloning plasmid for the ANK1 gene.

Ankyrin 1 (ANK1) Antibody
abx037600-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ankyrin 1 (ANK1) Antibody
abx430864-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Ankyrin R (ANK1) Antibody
abx445096-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Mouse ANK1 shRNA Plasmid
20-abx969140	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ANK1 shRNA Plasmid
20-abx950199	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ANK1 ELISA KIT|Human
EF004617	Lifescience Market	96 Tests	EUR 689

Ankyrin 1, Erythrocytic (ANK1) Antibody
20-abx128802	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Polyclonal ANK1 antibody - middle region
APR00810G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ANK1 - middle region. This antibody is tested and proven to work in the following applications:

Ankyrin R (ANK1) Antibody (ALP)
abx442493-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (APC)
abx442774-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (Biotin)
abx443054-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (FITC)
abx443334-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (HRP)
abx443615-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (PerCP)
abx444177-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (RPE)
abx444458-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (Streptavidin)
abx444739-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

ANK1 ORF Vector (Human) (pORF)
ORF000405	ABM	1.0 ug DNA	EUR 95

ANK1 ORF Vector (Human) (pORF)
ORF000406	ABM	1.0 ug DNA	EUR 95

Ank1 ORF Vector (Mouse) (pORF)
ORF038594	ABM	1.0 ug DNA	EUR 1572

Ank1 ORF Vector (Mouse) (pORF)
ORF038595	ABM	1.0 ug DNA	EUR 1572

Ank1 ORF Vector (Rat) (pORF)
ORF063392	ABM	1.0 ug DNA	EUR 2080

Recombinant Ankyrin 1, Erythrocytic (ANK1)
4-RPB633Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P16157 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 40.5kDa Isoelectric Point: 7.5
Description: Recombinant Human Ankyrin 1, Erythrocytic expressed in: E.coli

Anti-Ankyrin 1 / ANK1 antibody
STJ71553	St John's Laboratory	100 µg	EUR 260

Human Ankyrin 1, Erythrocytic (ANK1) Protein
20-abx168126	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Ankyrin 1 (ANK1) ELISA Kit
abx384586-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 390)
abx440245-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 488)
abx440526-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 565)
abx440807-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 594)
abx441088-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 633)
abx441369-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 655)
abx441650-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 680)
abx441931-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 700)
abx442212-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mouse Ankyrin 1 (ANK1) ELISA Kit
abx388583-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Ankyrin- 1, Ank1 ELISA KIT
ELI-49245m	Lifescience Market	96 Tests	EUR 865

Human Ankyrin- 1, ANK1 ELISA KIT
ELI-49312h	Lifescience Market	96 Tests	EUR 824

Monkey Ankyrin 1(ANK1) ELISA kit
E09A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ankyrin 1(ANK1) ELISA kit
E09A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ankyrin 1(ANK1) ELISA kit
E09A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ANK1 sgRNA CRISPR Lentivector set (Human)
K0086301	ABM	3 x 1.0 ug	EUR 339

Goat Ankyrin 1(ANK1) ELISA kit
E06A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ankyrin 1(ANK1) ELISA kit
E06A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ankyrin 1(ANK1) ELISA kit
E06A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ankyrin 1(ANK1) ELISA kit
E07A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ankyrin 1(ANK1) ELISA kit
E07A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ankyrin 1(ANK1) ELISA kit
E07A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ankyrin 1(ANK1) ELISA kit
E04A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ankyrin 1(ANK1) ELISA kit
E04A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ankyrin 1(ANK1) ELISA kit
E04A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ankyrin 1(ANK1) ELISA kit
E02A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ankyrin 1(ANK1) ELISA kit
E02A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ankyrin 1(ANK1) ELISA kit
E02A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ankyrin 1(ANK1) ELISA kit
E08A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ankyrin 1(ANK1) ELISA kit
E08A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ankyrin 1(ANK1) ELISA kit
E08A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ankyrin 1(ANK1) ELISA kit
E03A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ankyrin 1(ANK1) ELISA kit
E03A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ankyrin 1(ANK1) ELISA kit
E03A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ankyrin 1(ANK1) ELISA kit
E01A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ankyrin 1(ANK1) ELISA kit
E01A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ankyrin 1(ANK1) ELISA kit
E01A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ank1 sgRNA CRISPR Lentivector set (Rat)
K6307301	ABM	3 x 1.0 ug	EUR 339

Ank1 sgRNA CRISPR Lentivector set (Mouse)
K3878001	ABM	3 x 1.0 ug	EUR 339

Polyclonal Ankyrin 1 / ANK1 Antibody (C-Term)
APG00534G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Ankyrin 1 / ANK1 (C-Term). This antibody is tested and proven to work in the following applications:

Ankyrin R (ANK1) Antibody (PE/ATTO 594)
abx443896-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

ANK1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0086302	ABM	1.0 ug DNA	EUR 154

ANK1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0086303	ABM	1.0 ug DNA	EUR 154

ANK1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0086304	ABM	1.0 ug DNA	EUR 154

Guinea pig Ankyrin 1(ANK1) ELISA kit
E05A1448-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ankyrin 1(ANK1) ELISA kit
E05A1448-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ankyrin 1(ANK1) ELISA kit
E05A1448-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ank1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6307302	ABM	1.0 ug DNA	EUR 154

Ank1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6307303	ABM	1.0 ug DNA	EUR 154

Ank1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6307304	ABM	1.0 ug DNA	EUR 154

Ank1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3878002	ABM	1.0 ug DNA	EUR 154

Ank1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3878003	ABM	1.0 ug DNA	EUR 154

Ank1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3878004	ABM	1.0 ug DNA	EUR 154

ANK1 Protein Vector (Human) (pPB-C-His)
PV001617	ABM	500 ng	EUR 329

ANK1 Protein Vector (Human) (pPB-N-His)
PV001618	ABM	500 ng	EUR 329

ANK1 Protein Vector (Human) (pPM-C-HA)
PV001619	ABM	500 ng	EUR 329

ANK1 Protein Vector (Human) (pPM-C-His)
PV001620	ABM	500 ng	EUR 329

ANK1 Protein Vector (Human) (pPB-C-His)
PV001621	ABM	500 ng	EUR 329

ANK1 Protein Vector (Human) (pPB-N-His)
PV001622	ABM	500 ng	EUR 329

ANK1 Protein Vector (Human) (pPM-C-HA)
PV001623	ABM	500 ng	EUR 329

ANK1 Protein Vector (Human) (pPM-C-His)
PV001624	ABM	500 ng	EUR 329

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human)
4-PAB633Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANK1 (Leu32~Leu369) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1)

ANK1 Protein Vector (Human) (pPB-His-MBP)
PV321786	ABM	500 ng	EUR 329

ANK1 Protein Vector (Human) (pPB-His-GST)
PV321787	ABM	500 ng	EUR 329

ANK1 Protein Vector (Rat) (pPB-C-His)
PV253566	ABM	500 ng	EUR 2853

ANK1 Protein Vector (Rat) (pPB-N-His)
PV253567	ABM	500 ng	EUR 2853

ANK1 Protein Vector (Rat) (pPM-C-HA)
PV253568	ABM	500 ng	EUR 2853

ANK1 Protein Vector (Rat) (pPM-C-His)
PV253569	ABM	500 ng	EUR 2853

ANK1 Protein Vector (Mouse) (pPB-C-His)
PV154374	ABM	500 ng	EUR 3068

ANK1 Protein Vector (Mouse) (pPB-N-His)
PV154375	ABM	500 ng	EUR 3068

ANK1 Protein Vector (Mouse) (pPM-C-HA)
PV154376	ABM	500 ng	EUR 3068

ANK1 Protein Vector (Mouse) (pPM-C-His)
PV154377	ABM	500 ng	EUR 3068

ANK1 Protein Vector (Mouse) (pPB-C-His)
PV154378	ABM	500 ng	EUR 3157

ANK1 Protein Vector (Mouse) (pPB-N-His)
PV154379	ABM	500 ng	EUR 3157

ANK1 Protein Vector (Mouse) (pPM-C-HA)
PV154380	ABM	500 ng	EUR 3157

ANK1 Protein Vector (Mouse) (pPM-C-His)
PV154381	ABM	500 ng	EUR 3157

ANK1 3'UTR Luciferase Stable Cell Line
TU000757	ABM	1.0 ml	EUR 1521

Ank1 3'UTR GFP Stable Cell Line
TU151791	ABM	1.0 ml	Ask for price

ANK1 3'UTR GFP Stable Cell Line
TU050757	ABM	1.0 ml	EUR 1521

Ank1 3'UTR Luciferase Stable Cell Line
TU200614	ABM	1.0 ml	Ask for price

Ank1 3'UTR Luciferase Stable Cell Line
TU101791	ABM	1.0 ml	Ask for price

Ank1 3'UTR GFP Stable Cell Line
TU250614	ABM	1.0 ml	Ask for price

Ank1 ELISA Kit| Mouse Ankyrin-1 ELISA Kit
EF014208	Lifescience Market	96 Tests	EUR 689

ANK1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV707337	ABM	1.0 ug DNA	EUR 316

ANK1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV707341	ABM	1.0 ug DNA	EUR 316

ANK1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV707342	ABM	1.0 ug DNA	EUR 316

ANK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV669001	ABM	1.0 ug DNA	EUR 2659

ANK1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV669005	ABM	1.0 ug DNA	EUR 2659

ANK1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV669006	ABM	1.0 ug DNA	EUR 2659

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), APC
4-PAB633Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANK1 (Leu32~Leu369) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with APC.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), Biotinylated
4-PAB633Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANK1 (Leu32~Leu369) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with Biotin.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), Cy3
4-PAB633Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANK1 (Leu32~Leu369) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with Cy3.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), FITC
4-PAB633Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANK1 (Leu32~Leu369) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with FITC.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), HRP
4-PAB633Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANK1 (Leu32~Leu369) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with HRP.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), PE
4-PAB633Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANK1 (Leu32~Leu369) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with PE.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), APC-Cy7
4-PAB633Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANK1 (Leu32~Leu369) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with APC-Cy7.

ANK1 Protein Vector (Human) (pPM-N-D-C-HA)
PV321788	ABM	500 ng	EUR 552

ANK1 Protein Vector (Human) (pPM-N-D-C-His)
PV321789	ABM	500 ng	EUR 552

ANK1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0086305	ABM	3 x 1.0 ug	EUR 376

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6307305	ABM	3 x 1.0 ug	EUR 376

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3878005	ABM	3 x 1.0 ug	EUR 376

ANK1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0086306	ABM	1.0 ug DNA	EUR 167

ANK1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0086307	ABM	1.0 ug DNA	EUR 167

ANK1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0086308	ABM	1.0 ug DNA	EUR 167

ANK1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV707338	ABM	1.0 ug DNA	EUR 316

ANK1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV707339	ABM	1.0 ug DNA	EUR 374

ANK1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV707340	ABM	1.0 ug DNA	EUR 374

ANK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV669002	ABM	1.0 ug DNA	EUR 2659

ANK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV669003	ABM	1.0 ug DNA	EUR 2717

ANK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV669004	ABM	1.0 ug DNA	EUR 2717

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6307306	ABM	1.0 ug DNA	EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6307307	ABM	1.0 ug DNA	EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6307308	ABM	1.0 ug DNA	EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3878006	ABM	1.0 ug DNA	EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3878007	ABM	1.0 ug DNA	EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3878008	ABM	1.0 ug DNA	EUR 167

We apply this mannequin to a single cluster of inositol trisphosphate (IP 3) receptor channels and discover additional proof for the outcomes introduced in earlier work: a single cluster could also be succesful of producing completely different calcium launch sorts, the place long-lasting occasions are accompanied by unbinding of IP Three from the receptor (Rückl et al., PLoS Comput. Biol. 11, e1003965 (2015)).

Finally, we present the practicability of the mannequin in a grid of 64 clusters which is computationally intractable with earlier high-resolution fashions. Here long-lasting occasions can lead to synchronized oscillations and waves, whereas brief occasions keep localized. The frequency of calcium releases in addition to their coherence can thereby be regulated by the amplitude of IP Three stimulation. Finally the mannequin permits for a brand new rationalization of oscillating [IP 3], which isn’t based mostly on metabolic manufacturing and degradation of IP 3.