Structural insights into binding of STAC proteins to voltage-gated calcium channels.

Excitation-contraction (EC) coupling in skeletal muscle requires purposeful and mechanical coupling between L-type voltage-gated calcium channels (CaV1.1) and the ryanodine receptor (RyR1). Recently, STAC3 was recognized as an important protein for EC coupling and is an element of a gaggle of three proteins that may bind and modulate L-type voltage-gated calcium channels.

Here, we report crystal constructions of tandem-SH3 domains of completely different STAC isoforms up to 1.2-Å decision. These type a inflexible interplay by means of a conserved interdomain interface. We determine the linker connecting transmembrane repeats II and III in two completely different CaV isoforms as a binding website for the SH3 domains and report a crystal construction of the complicated with the STAC2 isoform.

The interplay website contains the placement for a illness variant in STAC3 that has been linked to Native American myopathy (NAM). Introducing the mutation doesn’t trigger misfolding of the SH3 domains, however abolishes the interplay. Disruption of the interplay through mutations within the II-III loop perturbs skeletal muscle EC coupling, however preserves the flexibility of STAC3 to decelerate inactivation of CaV1.2.

Calcium waves in a grid of clustered channels with synchronous IP3 binding and unbinding.

Calcium indicators in cells happen at a number of spatial scales and variable temporal length. However, a bodily rationalization for transitions between long-lasting international oscillations and localized short-term elevations (puffs) of cytoplasmic Ca2+ remains to be missing.

Here we introduce a phenomenological, coarse-grained mannequin for the calcium variable, which is represented by bizarre differential equations. Due to its small quantity of parameters, and its simplicity, this mannequin permits us to numerically research the interaction of multi-scale calcium concentrations with stochastic ion channel gating dynamics even in bigger techniques.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ANK1 cloning plasmid

CSB-CL001720HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 468
  • Sequence: atgtggactttcgtcacccagctgttggtcacgctggtgctgctgagcttcttcctggtcagctgtcagaacgtgatgcacattgtcagggggtccctgtgctttgtgctaaagcacatccaccaggagctggacaaggagctgggggagagcgaggacctcagtgacgacgagga
  • Show more
Description: A cloning plasmid for the ANK1 gene.

ANK1 cloning plasmid

CSB-CL001720HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 396
  • Sequence: atgtggactttcgtcacccagctgttggtcacgctggtgctgctgagcttcttcctggtcagctgtcagaacgtgatgcacattgtcagggggtccctgtgctttgtgctaaagcacatccaccaggagctggacaaggagctgggggagagcgagggcctcagtgacgacgagga
  • Show more
Description: A cloning plasmid for the ANK1 gene.


EF004617 96 Tests
EUR 689

Ankyrin 1 (ANK1) Antibody

abx037600-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ankyrin R (ANK1) Antibody

abx445096-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Ankyrin 1 (ANK1) Antibody

abx430864-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Human ANK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ANK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal ANK1 antibody - middle region

APR00810G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ANK1 - middle region. This antibody is tested and proven to work in the following applications:

Ankyrin 1, Erythrocytic (ANK1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ankyrin R (ANK1) Antibody (ALP)

abx442493-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (APC)

abx442774-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (Biotin)

abx443054-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (FITC)

abx443334-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (HRP)

abx443615-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (PerCP)

abx444177-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (RPE)

abx444458-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (Streptavidin)

abx444739-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

ANK1 ORF Vector (Human) (pORF)

ORF000405 1.0 ug DNA
EUR 95

ANK1 ORF Vector (Human) (pORF)

ORF000406 1.0 ug DNA
EUR 95

Ank1 ORF Vector (Mouse) (pORF)

ORF038594 1.0 ug DNA
EUR 1572

Ank1 ORF Vector (Mouse) (pORF)

ORF038595 1.0 ug DNA
EUR 1572

Ank1 ORF Vector (Rat) (pORF)

ORF063392 1.0 ug DNA
EUR 2080

Recombinant Ankyrin 1, Erythrocytic (ANK1)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P16157
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.5kDa
  • Isoelectric Point: 7.5
Description: Recombinant Human Ankyrin 1, Erythrocytic expressed in: E.coli

Anti-Ankyrin 1 / ANK1 antibody

STJ71553 100 µg
EUR 260

Goat Ankyrin 1(ANK1) ELISA kit

E06A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ankyrin 1(ANK1) ELISA kit

E06A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ankyrin 1(ANK1) ELISA kit

E06A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ankyrin 1(ANK1) ELISA kit

E02A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ankyrin 1(ANK1) ELISA kit

E02A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ankyrin 1(ANK1) ELISA kit

E02A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ankyrin 1(ANK1) ELISA kit

E03A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ankyrin 1(ANK1) ELISA kit

E03A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ankyrin 1(ANK1) ELISA kit

E03A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ankyrin 1(ANK1) ELISA kit

E04A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ankyrin 1(ANK1) ELISA kit

E04A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ankyrin 1(ANK1) ELISA kit

E04A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ankyrin 1(ANK1) ELISA kit

E01A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ankyrin 1(ANK1) ELISA kit

E01A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ankyrin 1(ANK1) ELISA kit

E01A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ankyrin 1(ANK1) ELISA kit

E07A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ankyrin 1(ANK1) ELISA kit

E07A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ankyrin 1(ANK1) ELISA kit

E07A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ankyrin 1(ANK1) ELISA kit

E09A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ankyrin 1(ANK1) ELISA kit

E09A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ankyrin 1(ANK1) ELISA kit

E09A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ankyrin 1(ANK1) ELISA kit

E08A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ankyrin 1(ANK1) ELISA kit

E08A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ankyrin 1(ANK1) ELISA kit

E08A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ANK1 sgRNA CRISPR Lentivector set (Human)

K0086301 3 x 1.0 ug
EUR 339

Mouse Ankyrin- 1, Ank1 ELISA KIT

ELI-49245m 96 Tests
EUR 865

Human Ankyrin- 1, ANK1 ELISA KIT

ELI-49312h 96 Tests
EUR 824

Human Ankyrin 1, Erythrocytic (ANK1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ankyrin 1 (ANK1) ELISA Kit

abx384586-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 390)

abx440245-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 488)

abx440526-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 565)

abx440807-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 594)

abx441088-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 633)

abx441369-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 655)

abx441650-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 680)

abx441931-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Ankyrin R (ANK1) Antibody (ATTO 700)

abx442212-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mouse Ankyrin 1 (ANK1) ELISA Kit

abx388583-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Ank1 sgRNA CRISPR Lentivector set (Mouse)

K3878001 3 x 1.0 ug
EUR 339

Ank1 sgRNA CRISPR Lentivector set (Rat)

K6307301 3 x 1.0 ug
EUR 339

Polyclonal Ankyrin 1 / ANK1 Antibody (C-Term)

APG00534G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Ankyrin 1 / ANK1 (C-Term). This antibody is tested and proven to work in the following applications:

Guinea pig Ankyrin 1(ANK1) ELISA kit

E05A1448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ankyrin 1(ANK1) ELISA kit

E05A1448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ankyrin 1(ANK1) ELISA kit

E05A1448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ankyrin 1(ANK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ANK1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0086302 1.0 ug DNA
EUR 154

ANK1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0086303 1.0 ug DNA
EUR 154

ANK1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0086304 1.0 ug DNA
EUR 154

Ankyrin R (ANK1) Antibody (PE/ATTO 594)

abx443896-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Ank1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3878002 1.0 ug DNA
EUR 154

Ank1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3878003 1.0 ug DNA
EUR 154

Ank1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3878004 1.0 ug DNA
EUR 154

Ank1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6307302 1.0 ug DNA
EUR 154

Ank1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6307303 1.0 ug DNA
EUR 154

Ank1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6307304 1.0 ug DNA
EUR 154

ANK1 Protein Vector (Human) (pPB-C-His)

PV001617 500 ng
EUR 329

ANK1 Protein Vector (Human) (pPB-N-His)

PV001618 500 ng
EUR 329

ANK1 Protein Vector (Human) (pPM-C-HA)

PV001619 500 ng
EUR 329

ANK1 Protein Vector (Human) (pPM-C-His)

PV001620 500 ng
EUR 329

ANK1 Protein Vector (Human) (pPB-C-His)

PV001621 500 ng
EUR 329

ANK1 Protein Vector (Human) (pPB-N-His)

PV001622 500 ng
EUR 329

ANK1 Protein Vector (Human) (pPM-C-HA)

PV001623 500 ng
EUR 329

ANK1 Protein Vector (Human) (pPM-C-His)

PV001624 500 ng
EUR 329

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANK1 (Leu32~Leu369)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1)

ANK1 Protein Vector (Mouse) (pPB-C-His)

PV154374 500 ng
EUR 3068

ANK1 Protein Vector (Mouse) (pPB-N-His)

PV154375 500 ng
EUR 3068

ANK1 Protein Vector (Mouse) (pPM-C-HA)

PV154376 500 ng
EUR 3068

ANK1 Protein Vector (Mouse) (pPM-C-His)

PV154377 500 ng
EUR 3068

ANK1 Protein Vector (Mouse) (pPB-C-His)

PV154378 500 ng
EUR 3157

ANK1 Protein Vector (Mouse) (pPB-N-His)

PV154379 500 ng
EUR 3157

ANK1 Protein Vector (Mouse) (pPM-C-HA)

PV154380 500 ng
EUR 3157

ANK1 Protein Vector (Mouse) (pPM-C-His)

PV154381 500 ng
EUR 3157

ANK1 Protein Vector (Human) (pPB-His-MBP)

PV321786 500 ng
EUR 329

ANK1 Protein Vector (Human) (pPB-His-GST)

PV321787 500 ng
EUR 329

ANK1 Protein Vector (Rat) (pPB-C-His)

PV253566 500 ng
EUR 2853

ANK1 Protein Vector (Rat) (pPB-N-His)

PV253567 500 ng
EUR 2853

ANK1 Protein Vector (Rat) (pPM-C-HA)

PV253568 500 ng
EUR 2853

ANK1 Protein Vector (Rat) (pPM-C-His)

PV253569 500 ng
EUR 2853

Ank1 3'UTR Luciferase Stable Cell Line

TU200614 1.0 ml Ask for price

Ank1 3'UTR GFP Stable Cell Line

TU151791 1.0 ml Ask for price

ANK1 3'UTR Luciferase Stable Cell Line

TU000757 1.0 ml
EUR 1521

Ank1 3'UTR Luciferase Stable Cell Line

TU101791 1.0 ml Ask for price

ANK1 3'UTR GFP Stable Cell Line

TU050757 1.0 ml
EUR 1521

Ank1 3'UTR GFP Stable Cell Line

TU250614 1.0 ml Ask for price

Ank1 ELISA Kit| Mouse Ankyrin-1 ELISA Kit

EF014208 96 Tests
EUR 689

ANK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV669001 1.0 ug DNA
EUR 2659

ANK1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV669005 1.0 ug DNA
EUR 2659

ANK1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV669006 1.0 ug DNA
EUR 2659

ANK1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV707337 1.0 ug DNA
EUR 316

ANK1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV707341 1.0 ug DNA
EUR 316

ANK1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV707342 1.0 ug DNA
EUR 316

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANK1 (Leu32~Leu369)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with APC.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANK1 (Leu32~Leu369)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with Biotin.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANK1 (Leu32~Leu369)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with Cy3.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANK1 (Leu32~Leu369)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with FITC.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANK1 (Leu32~Leu369)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with HRP.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANK1 (Leu32~Leu369)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with PE.

Ankyrin 1, Erythrocytic (ANK1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANK1 (Leu32~Leu369)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ankyrin 1, Erythrocytic (ANK1). This antibody is labeled with APC-Cy7.

ANK1 Protein Vector (Human) (pPM-N-D-C-HA)

PV321788 500 ng
EUR 552

ANK1 Protein Vector (Human) (pPM-N-D-C-His)

PV321789 500 ng
EUR 552

ANK1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0086305 3 x 1.0 ug
EUR 376

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3878005 3 x 1.0 ug
EUR 376

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6307305 3 x 1.0 ug
EUR 376

ANK1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0086306 1.0 ug DNA
EUR 167

ANK1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0086307 1.0 ug DNA
EUR 167

ANK1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0086308 1.0 ug DNA
EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3878006 1.0 ug DNA
EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3878007 1.0 ug DNA
EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3878008 1.0 ug DNA
EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6307306 1.0 ug DNA
EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6307307 1.0 ug DNA
EUR 167

Ank1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6307308 1.0 ug DNA
EUR 167

ANK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV669002 1.0 ug DNA
EUR 2659

ANK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV669003 1.0 ug DNA
EUR 2717

ANK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV669004 1.0 ug DNA
EUR 2717

ANK1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV707338 1.0 ug DNA
EUR 316

ANK1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV707339 1.0 ug DNA
EUR 374

ANK1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV707340 1.0 ug DNA
EUR 374

We apply this mannequin to a single cluster of inositol trisphosphate (IP 3) receptor channels and discover additional proof for the outcomes introduced in earlier work: a single cluster could also be succesful of producing completely different calcium launch sorts, the place long-lasting occasions are accompanied by unbinding of IP Three from the receptor (Rückl et al., PLoS Comput. Biol. 11, e1003965 (2015)).

Finally, we present the practicability of the mannequin in a grid of 64 clusters which is computationally intractable with earlier high-resolution fashions. Here long-lasting occasions can lead to synchronized oscillations and waves, whereas brief occasions keep localized. The frequency of calcium releases in addition to their coherence can thereby be regulated by the amplitude of IP Three stimulation. Finally the mannequin permits for a brand new rationalization of oscillating [IP 3], which isn’t based mostly on metabolic manufacturing and degradation of IP 3.

Leave a Reply

Your email address will not be published. Required fields are marked *