Mouse UMOD(Uromodulin) ELISA Kit

Mouse UMOD(Uromodulin) ELISA Kit

To Order Contact us now: 

Mouse Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Uromodulin (UMOD) ELISA Kit
RD-UMOD-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Uromodulin (UMOD) ELISA Kit
RD-UMOD-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Hu-48T	DL Develop	48T	EUR 517
Should the Human Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Human Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Hu-96T	DL Develop	96T	EUR 673
Should the Human Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Human Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Uromodulin (UMOD) ELISA Kit
RD-UMOD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Uromodulin (UMOD) ELISA Kit
RD-UMOD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Uromodulin (UMOD) ELISA Kit
RD-UMOD-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Uromodulin (UMOD) ELISA Kit
RD-UMOD-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Mouse Uromodulin(UMOD) ELISA kit
CSB-EL025616MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Uromodulin (UMOD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Uromodulin(UMOD) ELISA kit
1-CSB-EL025616MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Uromodulin(UMOD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Uromodulin (UMOD) ELISA Kit
20-abx154835	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Uromodulin (UMOD) ELISA Kit
abx254464-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse Umod/ Uromodulin ELISA Kit
E1563Mo	Sunlong	1 Kit	EUR 571

Mouse Uromodulin, Umod ELISA KIT
ELI-07300m	Lifescience Market	96 Tests	EUR 865

Mouse Uromodulin (UMOD) ELISA Kit
abx575290-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse Uromodulin ELISA Kit (UMOD)
RK03267	Abclonal	96 Tests	EUR 521

Mouse Uromodulin(UMOD)ELISA kit
QY-E21574	Qayee Biotechnology	96T	EUR 361

Mouse Uromodulin (UMOD) ELISA Kit
SEG918Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit
SEG918Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit
SEG918Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit
SEG918Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit
4-SEG918Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP Uromucoid, Tamm-Horsfall Glycoprotein Tamm-Horsfall urinary glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Uromodulin (Umod)
1-CSB-YP025616MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 64.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uromodulin(Umod),partial expressed in Yeast

ELISA kit for Mouse UMOD (Uromodulin)
ELK6195	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD Show more
Description: A sandwich ELISA kit for detection of Uromodulin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Uromodulin (UMOD)
KTE70036-48T	Abbkine	48T	EUR 332
The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1 Show more
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Uromodulin (UMOD)
KTE70036-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1 Show more
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Uromodulin (UMOD)
KTE70036-96T	Abbkine	96T	EUR 539
The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1 Show more
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Uromodulin (UMOD) CLIA Kit
20-abx495330	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Uromodulin (UMOD) Protein
20-abx168347	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Uromodulin(UMOD) ELISA kit
CSB-EL025616RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Uromodulin (UMOD) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Uromodulin(UMOD) ELISA kit
1-CSB-EL025616RA	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Uromodulin(UMOD) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Uromodulin (UMOD) ELISA Kit
20-abx156212	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Uromodulin (UMOD) ELISA Kit
20-abx153446	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Uromodulin (UMOD) ELISA Kit
abx256048-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Uromodulin (UMOD) ELISA Kit
20-abx258401	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Uromodulin (UMOD) ELISA Kit
abx251538-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Uromodulin (UMOD) ELISA Kit
abx253270-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human UMOD(Uromodulin) ELISA Kit
EH2197	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P07911 Alias: UMOD/ADMCKD2/FJHN/HNFJ/MCKD2/THGP/THP/UMOD/Uromucoid/ADMCKD2/FJHN/HNFJ/HNFJ1/MCKD2/Tamm-Horsfall glycoprotein/THGP/THP/uromodulin(uromucoid, Tamm-Horsfall glycoprotein)/uromucoid/Tamm-Horsfall Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Rat Umod/ Uromodulin ELISA Kit
E1022Ra	Sunlong	1 Kit	EUR 571

Human UMOD/ Uromodulin ELISA Kit
E2642Hu	Sunlong	1 Kit	EUR 571

Rat Uromodulin, Umod ELISA KIT
ELI-07296r	Lifescience Market	96 Tests	EUR 886

Bovine Uromodulin, UMOD ELISA KIT
ELI-07297b	Lifescience Market	96 Tests	EUR 928

Human Uromodulin, UMOD ELISA KIT
ELI-07298h	Lifescience Market	96 Tests	EUR 824

Canine Uromodulin, UMOD ELISA KIT
ELI-07299d	Lifescience Market	96 Tests	EUR 928

Rat Uromodulin (UMOD) ELISA Kit
abx575289-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Uromodulin (UMOD) ELISA Kit
abx575301-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Cow Uromodulin (UMOD) ELISA Kit
abx519957-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dog Uromodulin (UMOD) ELISA Kit
abx519958-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Uromodulin(UMOD)ELISA Kit
QY-E02062	Qayee Biotechnology	96T	EUR 361

Rat Uromodulin(UMOD)ELISA kit
QY-E10104	Qayee Biotechnology	96T	EUR 361

Human Uromodulin ELISA Kit (UMOD)
RK02479	Abclonal	96 Tests	EUR 521

Rat Uromodulin ELISA Kit (UMOD)
RK04012	Abclonal	96 Tests	EUR 521

Human Uromodulin (UMOD) ELISA Kit
SEG918Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Human Uromodulin (UMOD) ELISA Kit
SEG918Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Human Uromodulin (UMOD) ELISA Kit
SEG918Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Human Uromodulin (UMOD) ELISA Kit
SEG918Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Human Uromodulin (UMOD) ELISA Kit
4-SEG918Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP Uromucoid, Tamm-Horsfall Glycoprotein Tamm-Horsfall urinary glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Uromodulin (UMOD) ELISA Kit
SEG918Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit
SEG918Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit
SEG918Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit
SEG918Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit
4-SEG918Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP Uromucoid, Tamm-Horsfall Glycoprotein Tamm-Horsfall urinary glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Uromodulin (UMOD) Antibody
20-abx008590	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody
20-abx178822	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Uromodulin (UMOD) Antibody
20-abx178823	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx100690	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx100691	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx100692	Abbexa	EUR 467.00 EUR 133.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx116546	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody
20-abx129707	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx175043	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Uromodulin (UMOD) Antibody
abx239294-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Uromodulin (UMOD) Antibody
20-abx323479	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody
abx433429-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Uromodulin (UMOD) Antibody
abx433430-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Uromodulin (UMOD) Antibody
20-abx001568	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Uromodulin (UMOD)
4-RPG918Ca01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q862Z3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 13.8kDa Isoelectric Point: Inquire
Description: Recombinant Dog Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)
4-RPG918Hu01	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07911 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01%skl, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.8kDa Isoelectric Point: 7.1
Description: Recombinant Human Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)
4-RPG918Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q91X17 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 60.8kDa Isoelectric Point: 6.4
Description: Recombinant Mouse Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)
4-RPG918Ra01	Cloud-Clone	EUR 522.91 EUR 243.00 EUR 1685.92 EUR 628.64 EUR 1157.28 EUR 413.00 EUR 4064.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P27590 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.5kDa Isoelectric Point: Inquire
Description: Recombinant Rat Uromodulin expressed in: E.coli

Human Uromodulin/umod PicoKine ELISA Kit
EK1690	BosterBio	96 wells	EUR 455
Description: For quantitative detection of human Uromodulin in cell culture supernates, serum and plasma (heparin).

ELISA kit for Human UMOD (Uromodulin)
ELK3807	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD Show more
Description: A sandwich ELISA kit for detection of Uromodulin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat UMOD (Uromodulin)
ELK6138	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD Show more
Description: A sandwich ELISA kit for detection of Uromodulin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Uromodulin (UMOD)
KTE100854-48T	Abbkine	48T	EUR 332
Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. Show more
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Uromodulin (UMOD)
KTE100854-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. Show more
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Uromodulin (UMOD)
KTE100854-96T	Abbkine	96T	EUR 539
Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. Show more
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Uromodulin (UMOD) Polyclonal Antibody (Mouse)
4-PAG918Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu335~Ser590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD)

Human Uromodulin (UMOD) CLIA Kit
20-abx490738	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Uromodulin (UMOD) CLIA Kit
20-abx495329	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Uromodulin (UMOD) CLIA Kit
20-abx495331	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Uromodulin (UMOD) Protein
20-abx069612	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Uromodulin (UMOD) Protein
20-abx069613	Abbexa	EUR 732.00 EUR 286.00 EUR 2277.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dog Uromodulin (UMOD) Protein
20-abx069614	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

OVA Conjugated Uromodulin (UMOD)
4-CPG918Hu21	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07911 Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Human Uromodulin expressed in: chemical synthesis

Uromodulin (UMOD) Antibody (Biotin)
20-abx271676	Abbexa	EUR 495.00 EUR 258.00 EUR 1469.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Uromodulin (UMOD) Antibody (Biotin)
20-abx272397	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody Pair
20-abx370002	Abbexa	EUR 1483.00 EUR 954.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

UMOD Uromodulin Human protein
PROTP07911	BosterBio	Regular: 10ug	EUR 317
Description: Uromodulin Human Native protein produced from Human Urine, is a glycosylated polypeptide chain containing 590 amino acids, having a total Mw of 64.25 kDa (excluding glycosylation).

High Sensitive Human Uromodulin (UMOD) ELISA Kit
HEG918Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

High Sensitive Human Uromodulin (UMOD) ELISA Kit
HEG918Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

High Sensitive Human Uromodulin (UMOD) ELISA Kit
HEG918Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

High Sensitive Human Uromodulin (UMOD) ELISA Kit
HEG918Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

High Sensitive Human Uromodulin (UMOD) ELISA Kit
4-HEG918Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP Uromucoid, Tamm-Horsfall Glycoprotein Tamm-Horsfall urinary glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), APC
4-PAG918Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu335~Ser590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with APC.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), Biotinylated
4-PAG918Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu335~Ser590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with Biotin.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), Cy3
4-PAG918Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu335~Ser590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), FITC
4-PAG918Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu335~Ser590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with FITC.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), HRP
4-PAG918Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu335~Ser590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with HRP.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), PE
4-PAG918Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu335~Ser590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with PE.

Polyclonal UMOD / Uromodulin Antibody (Val378)
APR03149G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD / Uromodulin (Val378). This antibody is tested and proven to work in the following applications:

Uromodulin (UMOD) Polyclonal Antibody (Dog)
4-PAG918Ca01	Cloud-Clone	EUR 268.00 EUR 2840.00 EUR 700.00 EUR 340.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Arg32~Glu151) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD)

Uromodulin (UMOD) Polyclonal Antibody (Rat)
4-PAG918Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu30~Glu150) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD)

Uromodulin (UMOD) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG918Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu335~Ser590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with APC-Cy7.

Uromodulin (UMOD) Polyclonal Antibody (Dog), APC
4-PAG918Ca01-APC	Cloud-Clone	EUR 377.00 EUR 3725.00 EUR 1025.00 EUR 485.00 EUR 233.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Arg32~Glu151) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with APC.

Uromodulin (UMOD) Polyclonal Antibody (Dog), Biotinylated
4-PAG918Ca01-Biotin	Cloud-Clone	EUR 334.00 EUR 2790.00 EUR 810.00 EUR 414.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Arg32~Glu151) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with Biotin.

Uromodulin (UMOD) Polyclonal Antibody (Dog), Cy3
4-PAG918Ca01-Cy3	Cloud-Clone	EUR 461.00 EUR 4925.00 EUR 1325.00 EUR 605.00 EUR 269.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Arg32~Glu151) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Dog), FITC
4-PAG918Ca01-FITC	Cloud-Clone	EUR 321.00 EUR 3000.00 EUR 840.00 EUR 408.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Arg32~Glu151) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with FITC.

Uromodulin (UMOD) Polyclonal Antibody (Dog), HRP
4-PAG918Ca01-HRP	Cloud-Clone	EUR 343.00 EUR 3245.00 EUR 905.00 EUR 437.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Arg32~Glu151) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with HRP.

Uromodulin (UMOD) Polyclonal Antibody (Dog), PE
4-PAG918Ca01-PE	Cloud-Clone	EUR 321.00 EUR 3000.00 EUR 840.00 EUR 408.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Arg32~Glu151) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with PE.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig)
4-PAG918Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu334~Ser589) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD)

Uromodulin (UMOD) Polyclonal Antibody (Rat), APC
4-PAG918Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu30~Glu150) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with APC.

Uromodulin (UMOD) Polyclonal Antibody (Rat), Biotinylated
4-PAG918Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu30~Glu150) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with Biotin.

Uromodulin (UMOD) Polyclonal Antibody (Rat), Cy3
4-PAG918Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu30~Glu150) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Rat), FITC
4-PAG918Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu30~Glu150) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with FITC.

Uromodulin (UMOD) Polyclonal Antibody (Rat), HRP
4-PAG918Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu30~Glu150) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with HRP.

Uromodulin (UMOD) Polyclonal Antibody (Rat), PE
4-PAG918Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu30~Glu150) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with PE.

Uromodulin (UMOD) Polyclonal Antibody (Dog), APC-Cy7
4-PAG918Ca01-APC-Cy7	Cloud-Clone	EUR 634.00 EUR 7330.00 EUR 1930.00 EUR 850.00 EUR 346.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Arg32~Glu151) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with APC-Cy7.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), APC
4-PAG918Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu334~Ser589) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with APC.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAG918Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu334~Ser589) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with Biotin.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), Cy3
4-PAG918Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu334~Ser589) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), FITC
4-PAG918Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu334~Ser589) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with FITC.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), HRP
4-PAG918Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu334~Ser589) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with HRP.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), PE
4-PAG918Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu334~Ser589) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with PE.

Uromodulin (UMOD) Polyclonal Antibody (Rat), APC-Cy7
4-PAG918Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu30~Glu150) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with APC-Cy7.

Mouse Uromodulin ELISA kit
E03U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Uromodulin ELISA kit
E03U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Uromodulin ELISA kit
E03U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal UMOD / Uromodulin Antibody (clone 10.32), Clone: 10.32
AMM01787G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human UMOD / Uromodulin (clone 10.32). The antibodies are raised in Mouse and are from clone 10.32. This antibody is applicable in IHC-P, IF, IHC-Fr

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAG918Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UMOD (Glu334~Ser589) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with APC-Cy7.

ELISA kit for Mouse Uromodulin
EK4470	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Uromodulin ELISA kit
E02U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uromodulin ELISA kit
E02U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uromodulin ELISA kit
E02U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uromodulin ELISA kit
E04U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uromodulin ELISA kit
E04U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uromodulin ELISA kit
E04U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uromodulin ELISA kit
E01U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uromodulin ELISA kit
E01U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uromodulin ELISA kit
E01U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uromodulin ELISA kit
E07U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uromodulin ELISA kit
E07U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uromodulin ELISA kit
E07U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uromodulin ELISA kit
E08U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uromodulin ELISA kit
E08U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uromodulin ELISA kit
E08U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uromodulin ELISA kit
E09U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uromodulin ELISA kit
E09U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uromodulin ELISA kit
E09U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uromodulin ELISA kit
E06U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uromodulin ELISA kit
E06U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uromodulin ELISA kit
E06U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UMOD ELISA Kit
ELA-E2280h	Lifescience Market	96 Tests	EUR 824

UMOD ELISA KIT|Human
EF006268	Lifescience Market	96 Tests	EUR 689

Rat UMOD ELISA Kit
STJ150397	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of THP in Rat serum, plasma and other biological fluids

ELISA kit for Mouse Uromodulin-like 1
EK3737	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Uromodulin-like 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Umodl1/ Uromodulin-like 1 ELISA Kit
E1564Mo	Sunlong	1 Kit	EUR 632

Mouse Uromodulin- like 1, Umodl1 ELISA KIT
ELI-17841m	Lifescience Market	96 Tests	EUR 865

Mouse Uromodulin-Like 1 (UMODL1) ELISA Kit
abx555573-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Guinea pig Uromodulin ELISA kit
E05U0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Uromodulin ELISA kit
E05U0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Uromodulin ELISA kit
E05U0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Uromodulin
EK4469	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Uromodulin
EK4471	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

Umodl1 ELISA Kit| Mouse Uromodulin-like 1 ELISA Kit
EF016476	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse UMOD shRNA Plasmid
20-abx973312	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UMOD Recombinant Protein (Mouse)
RP183092	ABM	100 ug	Ask for price

Human Uromodulin DuoSet ELISA
55R-2264	Fitzgerald	5 x 96 wells	EUR 702
Description: ELISA kit for detection of Human Uromodulin

Human Uromodulin
7-03772	CHI Scientific	2µg	Ask for price

Human Uromodulin
7-03773	CHI Scientific	10µg	Ask for price

Human Uromodulin
7-03774	CHI Scientific	1mg	Ask for price

Canine Uromodulin
7-03775	CHI Scientific	2µg	Ask for price

Canine Uromodulin
7-03776	CHI Scientific	10µg	Ask for price

Canine Uromodulin
7-03777	CHI Scientific	1mg	Ask for price

Uromodulin antibody
70R-50530	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal Uromodulin antibody

Uromodulin antibody
70R-5800	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Uromodulin antibody raised against the middle region of UMOD

Uromodulin Enzyme
20-abx073760	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

UMOD antibody
70R-21166	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UMOD antibody

UMOD Antibody
32498-100ul	SAB	100ul	EUR 252

UMOD Antibody
1-CSB-PA060042	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

UMOD Antibody
DF6692	Affbiotech	200ul	EUR 304
Description: UMOD Antibody detects endogenous levels of total UMOD.

UMOD antibody
70R-8504	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal UMOD antibody

UMOD Antibody
1-CSB-PA025616GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

UMOD siRNA
20-abx905951	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UMOD siRNA
20-abx939015	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UMOD siRNA
20-abx939016	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UMOD Antibody
ABD6692	Lifescience Market	100 ug	EUR 438

Human Uromodulin-Like 1 (UMODL1) ELISA Kit
abx555852-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Human Uromodulin- like 1, UMODL1 ELISA KIT
ELI-39866h	Lifescience Market	96 Tests	EUR 824

Umod ORF Vector (Mouse) (pORF)
ORF061032	ABM	1.0 ug DNA	EUR 506

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Uromodulin Blocking Peptide
33R-6556	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UMOD antibody, catalog no. 70R-5800

Uromodulin Protein (OVA)
20-abx165606	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dog Uromodulin Enzyme
20-abx073755	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Pig Uromodulin Enzyme
20-abx073830	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Cat Uromodulin Enzyme
20-abx073947	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	0.1 mg 10 ug 2 µg
Shipped within 5-10 working days.

Uromodulin Blocking Peptide
20-abx063405	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

anti- Uromodulin antibody
FNab09294	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IHC: 1:20-1:500 IP: 1:200-1:2000 Immunogen: uromodulin Uniprot ID: P07911
Description: Antibody raised against Uromodulin

Anti-Uromodulin antibody
PAab09294	Lifescience Market	100 ug	EUR 386

Anti-Uromodulin antibody
STJ72847	St John's Laboratory	100 µg	EUR 359

UMOD Blocking Peptide
33R-7383	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UMOD antibody, catalog no. 70R-8504

UMOD Blocking Peptide
DF6692-BP	Affbiotech	1mg	EUR 195

UMOD Conjugated Antibody
C32498	SAB	100ul	EUR 397

UMOD cloning plasmid
CSB-CL025616HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1836 Sequence: atggggcagccatctctgacttggatgctgatggtggtggtggcctcttggttcatcacaactgcagccactgacacctcagaagcaagatggtgctctgaatgtcacagcaatgccacctgcacggaggatgaggccgttacgacgtgcacctgtcaggagggcttcaccggcg Show more
Description: A cloning plasmid for the UMOD gene.

UMOD Rabbit pAb
A1920-100ul	Abclonal	100 ul	EUR 308

UMOD Rabbit pAb
A1920-200ul	Abclonal	200 ul	EUR 459

UMOD Rabbit pAb
A1920-20ul	Abclonal	20 ul	EUR 183

UMOD Rabbit pAb
A1920-50ul	Abclonal	50 ul	EUR 223

Anti-UMOD antibody
STJ26043	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Umod sgRNA CRISPR Lentivector set (Mouse)
K4000601	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Polyclonal UMOD Antibody (Center)
APR03934G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD (Center). This antibody is tested and proven to work in the following applications:

Rat UMOD shRNA Plasmid
20-abx984809	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human UMOD shRNA Plasmid
20-abx955040	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UMOD Recombinant Protein (Rat)
RP235856	ABM	100 ug	Ask for price

UMOD Recombinant Protein (Human)
RP033967	ABM	100 ug	Ask for price

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Mouse Uromodulin Like Protein 1 (UMODL1) Protein
20-abx165944	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Recombinant Mouse Uromodulin Protein, His, Yeast-100ug
QP9459-ye-100ug	EnQuireBio	100ug	EUR 571

Recombinant Mouse Uromodulin Protein, His, Yeast-10ug
QP9459-ye-10ug	EnQuireBio	10ug	EUR 272

Recombinant Mouse Uromodulin Protein, His, Yeast-1mg
QP9459-ye-1mg	EnQuireBio	1mg	EUR 2303

Recombinant Mouse Uromodulin Protein, His, Yeast-200ug
QP9459-ye-200ug	EnQuireBio	200ug	EUR 898

Recombinant Mouse Uromodulin Protein, His, Yeast-500ug
QP9459-ye-500ug	EnQuireBio	500ug	EUR 1505

Recombinant Mouse Uromodulin Protein, His, Yeast-50ug
QP9459-ye-50ug	EnQuireBio	50ug	EUR 354

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Umod sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4000602	ABM	1.0 ug DNA	EUR 154

Umod sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4000603	ABM	1.0 ug DNA	EUR 154

Umod sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4000604	ABM	1.0 ug DNA	EUR 154

UMOD Protein Vector (Mouse) (pPB-C-His)
PV244126	ABM	500 ng	EUR 603

UMOD Protein Vector (Mouse) (pPB-N-His)
PV244127	ABM	500 ng	EUR 603

UMOD Protein Vector (Mouse) (pPM-C-HA)
PV244128	ABM	500 ng	EUR 603

UMOD Protein Vector (Mouse) (pPM-C-His)
PV244129	ABM	500 ng	EUR 603