Mouse UMOD(Uromodulin) ELISA Kit

Mouse UMOD(Uromodulin) ELISA Kit

To Order Contact us now: 

Mouse Uromodulin (UMOD) ELISA Kit

RDR-UMOD-Mu-48Tests 48 Tests
EUR 557

Mouse Uromodulin (UMOD) ELISA Kit

RDR-UMOD-Mu-96Tests 96 Tests
EUR 774

Mouse Uromodulin (UMOD) ELISA Kit

RD-UMOD-Mu-48Tests 48 Tests
EUR 533

Mouse Uromodulin (UMOD) ELISA Kit

RD-UMOD-Mu-96Tests 96 Tests
EUR 740

Human Uromodulin (UMOD) ELISA Kit

DLR-UMOD-Hu-48T 48T
EUR 517
  • Should the Human Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Human Uromodulin (UMOD) ELISA Kit

DLR-UMOD-Hu-96T 96T
EUR 673
  • Should the Human Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit

DLR-UMOD-Ra-48T 48T
EUR 549
  • Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit

DLR-UMOD-Ra-96T 96T
EUR 718
  • Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Human Uromodulin (UMOD) ELISA Kit

RDR-UMOD-Hu-48Tests 48 Tests
EUR 544

Human Uromodulin (UMOD) ELISA Kit

RDR-UMOD-Hu-96Tests 96 Tests
EUR 756

Rat Uromodulin (UMOD) ELISA Kit

RDR-UMOD-Ra-48Tests 48 Tests
EUR 583

Rat Uromodulin (UMOD) ELISA Kit

RDR-UMOD-Ra-96Tests 96 Tests
EUR 811

Human Uromodulin (UMOD) ELISA Kit

RD-UMOD-Hu-48Tests 48 Tests
EUR 521

Human Uromodulin (UMOD) ELISA Kit

RD-UMOD-Hu-96Tests 96 Tests
EUR 723

Rat Uromodulin (UMOD) ELISA Kit

RD-UMOD-Ra-48Tests 48 Tests
EUR 557

Rat Uromodulin (UMOD) ELISA Kit

RD-UMOD-Ra-96Tests 96 Tests
EUR 775

Mouse Uromodulin(UMOD) ELISA kit

CSB-EL025616MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Uromodulin (UMOD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Uromodulin(UMOD) ELISA kit

1-CSB-EL025616MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Uromodulin(UMOD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Uromodulin (UMOD) ELISA Kit

20-abx154835
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Uromodulin (UMOD) ELISA Kit

abx254464-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Umod/ Uromodulin ELISA Kit

E1563Mo 1 Kit
EUR 571

Mouse Uromodulin, Umod ELISA KIT

ELI-07300m 96 Tests
EUR 865

Mouse Uromodulin (UMOD) ELISA Kit

abx575290-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Uromodulin ELISA Kit (UMOD)

RK03267 96 Tests
EUR 521

Mouse Uromodulin(UMOD)ELISA kit

QY-E21574 96T
EUR 361

Mouse Uromodulin (UMOD) ELISA Kit

SEG918Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit

SEG918Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit

SEG918Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit

SEG918Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit

4-SEG918Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP
  • Uromucoid, Tamm-Horsfall Glycoprotein
  • Tamm-Horsfall urinary glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Uromodulin (Umod)

1-CSB-YP025616MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 64.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uromodulin(Umod),partial expressed in Yeast

ELISA kit for Mouse UMOD (Uromodulin)

ELK6195 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD
  • Show more
Description: A sandwich ELISA kit for detection of Uromodulin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Uromodulin (UMOD)

KTE70036-48T 48T
EUR 332
  • The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Uromodulin (UMOD)

KTE70036-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Uromodulin (UMOD)

KTE70036-96T 96T
EUR 539
  • The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Uromodulin (UMOD) CLIA Kit

20-abx495330
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Uromodulin (UMOD) Protein

20-abx168347
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Uromodulin(UMOD) ELISA kit

CSB-EL025616RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Uromodulin (UMOD) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Uromodulin(UMOD) ELISA kit

1-CSB-EL025616RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Uromodulin(UMOD) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Uromodulin (UMOD) ELISA Kit

20-abx156212
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Uromodulin (UMOD) ELISA Kit

20-abx153446
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Uromodulin (UMOD) ELISA Kit

abx256048-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Uromodulin (UMOD) ELISA Kit

20-abx258401
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Uromodulin (UMOD) ELISA Kit

abx251538-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Uromodulin (UMOD) ELISA Kit

abx253270-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human UMOD(Uromodulin) ELISA Kit

EH2197 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P07911
  • Alias: UMOD/ADMCKD2/FJHN/HNFJ/MCKD2/THGP/THP/UMOD/Uromucoid/ADMCKD2/FJHN/HNFJ/HNFJ1/MCKD2/Tamm-Horsfall glycoprotein/THGP/THP/uromodulin(uromucoid, Tamm-Horsfall glycoprotein)/uromucoid/Tamm-Horsfall
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Rat Umod/ Uromodulin ELISA Kit

E1022Ra 1 Kit
EUR 571

Human UMOD/ Uromodulin ELISA Kit

E2642Hu 1 Kit
EUR 571

Rat Uromodulin, Umod ELISA KIT

ELI-07296r 96 Tests
EUR 886

Bovine Uromodulin, UMOD ELISA KIT

ELI-07297b 96 Tests
EUR 928

Human Uromodulin, UMOD ELISA KIT

ELI-07298h 96 Tests
EUR 824

Canine Uromodulin, UMOD ELISA KIT

ELI-07299d 96 Tests
EUR 928

Rat Uromodulin (UMOD) ELISA Kit

abx575289-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Uromodulin (UMOD) ELISA Kit

abx575301-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Cow Uromodulin (UMOD) ELISA Kit

abx519957-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Uromodulin (UMOD) ELISA Kit

abx519958-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Uromodulin(UMOD)ELISA Kit

QY-E02062 96T
EUR 361

Rat Uromodulin(UMOD)ELISA kit

QY-E10104 96T
EUR 361

Human Uromodulin ELISA Kit (UMOD)

RK02479 96 Tests
EUR 521

Rat Uromodulin ELISA Kit (UMOD)

RK04012 96 Tests
EUR 521

Human Uromodulin (UMOD) ELISA Kit

SEG918Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Human Uromodulin (UMOD) ELISA Kit

SEG918Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Human Uromodulin (UMOD) ELISA Kit

SEG918Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Human Uromodulin (UMOD) ELISA Kit

SEG918Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Human Uromodulin (UMOD) ELISA Kit

4-SEG918Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP
  • Uromucoid, Tamm-Horsfall Glycoprotein
  • Tamm-Horsfall urinary glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Uromodulin (UMOD) ELISA Kit

SEG918Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit

SEG918Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit

SEG918Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit

SEG918Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit

4-SEG918Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP
  • Uromucoid, Tamm-Horsfall Glycoprotein
  • Tamm-Horsfall urinary glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Uromodulin (UMOD) Antibody

20-abx008590
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody

20-abx178822
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Uromodulin (UMOD) Antibody

20-abx178823
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody

20-abx100690
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody

20-abx100691
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody

20-abx100692
  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody

20-abx116546
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody

20-abx129707
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody

20-abx175043
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Uromodulin (UMOD) Antibody

abx239294-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Uromodulin (UMOD) Antibody

20-abx323479
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody

abx433429-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Uromodulin (UMOD) Antibody

abx433430-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Uromodulin (UMOD) Antibody

20-abx001568
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Uromodulin (UMOD)

4-RPG918Ca01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q862Z3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)

4-RPG918Hu01
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07911
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01%skl, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)

4-RPG918Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91X17
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.8kDa
  • Isoelectric Point: 6.4
Description: Recombinant Mouse Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)

4-RPG918Ra01
  • EUR 522.91
  • EUR 243.00
  • EUR 1685.92
  • EUR 628.64
  • EUR 1157.28
  • EUR 413.00
  • EUR 4064.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27590
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Uromodulin expressed in: E.coli

Human Uromodulin/umod PicoKine ELISA Kit

EK1690 96 wells
EUR 455
Description: For quantitative detection of human Uromodulin in cell culture supernates, serum and plasma (heparin).

ELISA kit for Human UMOD (Uromodulin)

ELK3807 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD
  • Show more
Description: A sandwich ELISA kit for detection of Uromodulin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat UMOD (Uromodulin)

ELK6138 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD
  • Show more
Description: A sandwich ELISA kit for detection of Uromodulin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Uromodulin (UMOD)

KTE100854-48T 48T
EUR 332
  • Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle.
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Uromodulin (UMOD)

KTE100854-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle.
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Uromodulin (UMOD)

KTE100854-96T 96T
EUR 539
  • Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle.
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Uromodulin (UMOD) Polyclonal Antibody (Mouse)

4-PAG918Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu335~Ser590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD)

Human Uromodulin (UMOD) CLIA Kit

20-abx490738
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Uromodulin (UMOD) CLIA Kit

20-abx495329
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Uromodulin (UMOD) CLIA Kit

20-abx495331
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Uromodulin (UMOD) Protein

20-abx069612
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Uromodulin (UMOD) Protein

20-abx069613
  • EUR 732.00
  • EUR 286.00
  • EUR 2277.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dog Uromodulin (UMOD) Protein

20-abx069614
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

OVA Conjugated Uromodulin (UMOD)

4-CPG918Hu21
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07911
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Uromodulin expressed in: chemical synthesis

Uromodulin (UMOD) Antibody (Biotin)

20-abx271676
  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Uromodulin (UMOD) Antibody (Biotin)

20-abx272397
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody Pair

20-abx370002
  • EUR 1483.00
  • EUR 954.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

UMOD Uromodulin Human protein

PROTP07911 Regular: 10ug
EUR 317
Description: Uromodulin Human Native protein produced from Human Urine, is a glycosylated polypeptide chain containing 590 amino acids, having a total Mw of 64.25 kDa (excluding glycosylation).

High Sensitive Human Uromodulin (UMOD) ELISA Kit

HEG918Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

High Sensitive Human Uromodulin (UMOD) ELISA Kit

HEG918Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

High Sensitive Human Uromodulin (UMOD) ELISA Kit

HEG918Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

High Sensitive Human Uromodulin (UMOD) ELISA Kit

HEG918Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids.

High Sensitive Human Uromodulin (UMOD) ELISA Kit

4-HEG918Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP
  • Uromucoid, Tamm-Horsfall Glycoprotein
  • Tamm-Horsfall urinary glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), APC

4-PAG918Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu335~Ser590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with APC.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), Biotinylated

4-PAG918Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu335~Ser590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with Biotin.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), Cy3

4-PAG918Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu335~Ser590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), FITC

4-PAG918Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu335~Ser590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with FITC.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), HRP

4-PAG918Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu335~Ser590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with HRP.

Uromodulin (UMOD) Polyclonal Antibody (Mouse), PE

4-PAG918Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu335~Ser590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with PE.

Polyclonal UMOD / Uromodulin Antibody (Val378)

APR03149G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD / Uromodulin (Val378). This antibody is tested and proven to work in the following applications:

Uromodulin (UMOD) Polyclonal Antibody (Dog)

4-PAG918Ca01
  • EUR 268.00
  • EUR 2840.00
  • EUR 700.00
  • EUR 340.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD)

Uromodulin (UMOD) Polyclonal Antibody (Rat)

4-PAG918Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu30~Glu150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD)

Uromodulin (UMOD) Polyclonal Antibody (Mouse), APC-Cy7

4-PAG918Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu335~Ser590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with APC-Cy7.

Uromodulin (UMOD) Polyclonal Antibody (Dog), APC

4-PAG918Ca01-APC
  • EUR 377.00
  • EUR 3725.00
  • EUR 1025.00
  • EUR 485.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with APC.

Uromodulin (UMOD) Polyclonal Antibody (Dog), Biotinylated

4-PAG918Ca01-Biotin
  • EUR 334.00
  • EUR 2790.00
  • EUR 810.00
  • EUR 414.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with Biotin.

Uromodulin (UMOD) Polyclonal Antibody (Dog), Cy3

4-PAG918Ca01-Cy3
  • EUR 461.00
  • EUR 4925.00
  • EUR 1325.00
  • EUR 605.00
  • EUR 269.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Dog), FITC

4-PAG918Ca01-FITC
  • EUR 321.00
  • EUR 3000.00
  • EUR 840.00
  • EUR 408.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with FITC.

Uromodulin (UMOD) Polyclonal Antibody (Dog), HRP

4-PAG918Ca01-HRP
  • EUR 343.00
  • EUR 3245.00
  • EUR 905.00
  • EUR 437.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with HRP.

Uromodulin (UMOD) Polyclonal Antibody (Dog), PE

4-PAG918Ca01-PE
  • EUR 321.00
  • EUR 3000.00
  • EUR 840.00
  • EUR 408.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with PE.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig)

4-PAG918Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu334~Ser589)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD)

Uromodulin (UMOD) Polyclonal Antibody (Rat), APC

4-PAG918Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu30~Glu150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with APC.

Uromodulin (UMOD) Polyclonal Antibody (Rat), Biotinylated

4-PAG918Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu30~Glu150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with Biotin.

Uromodulin (UMOD) Polyclonal Antibody (Rat), Cy3

4-PAG918Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu30~Glu150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Rat), FITC

4-PAG918Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu30~Glu150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with FITC.

Uromodulin (UMOD) Polyclonal Antibody (Rat), HRP

4-PAG918Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu30~Glu150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with HRP.

Uromodulin (UMOD) Polyclonal Antibody (Rat), PE

4-PAG918Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu30~Glu150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with PE.

Uromodulin (UMOD) Polyclonal Antibody (Dog), APC-Cy7

4-PAG918Ca01-APC-Cy7
  • EUR 634.00
  • EUR 7330.00
  • EUR 1930.00
  • EUR 850.00
  • EUR 346.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with APC-Cy7.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), APC

4-PAG918Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu334~Ser589)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with APC.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), Biotinylated

4-PAG918Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu334~Ser589)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with Biotin.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), Cy3

4-PAG918Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu334~Ser589)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), FITC

4-PAG918Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu334~Ser589)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with FITC.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), HRP

4-PAG918Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu334~Ser589)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with HRP.

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), PE

4-PAG918Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu334~Ser589)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with PE.

Uromodulin (UMOD) Polyclonal Antibody (Rat), APC-Cy7

4-PAG918Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu30~Glu150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with APC-Cy7.

Mouse Uromodulin ELISA kit

E03U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Uromodulin ELISA kit

E03U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Uromodulin ELISA kit

E03U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal UMOD / Uromodulin Antibody (clone 10.32), Clone: 10.32

AMM01787G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human UMOD / Uromodulin (clone 10.32). The antibodies are raised in Mouse and are from clone 10.32. This antibody is applicable in IHC-P, IF, IHC-Fr

Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), APC-Cy7

4-PAG918Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Glu334~Ser589)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with APC-Cy7.

ELISA kit for Mouse Uromodulin

EK4470 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Uromodulin ELISA kit

E02U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uromodulin ELISA kit

E02U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uromodulin ELISA kit

E02U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uromodulin ELISA kit

E04U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uromodulin ELISA kit

E04U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uromodulin ELISA kit

E04U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uromodulin ELISA kit

E01U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uromodulin ELISA kit

E01U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uromodulin ELISA kit

E01U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uromodulin ELISA kit

E07U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uromodulin ELISA kit

E07U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uromodulin ELISA kit

E07U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uromodulin ELISA kit

E08U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uromodulin ELISA kit

E08U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uromodulin ELISA kit

E08U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uromodulin ELISA kit

E09U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uromodulin ELISA kit

E09U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uromodulin ELISA kit

E09U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uromodulin ELISA kit

E06U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uromodulin ELISA kit

E06U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uromodulin ELISA kit

E06U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UMOD ELISA Kit

ELA-E2280h 96 Tests
EUR 824

UMOD ELISA KIT|Human

EF006268 96 Tests
EUR 689

Rat UMOD ELISA Kit

STJ150397 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of THP in Rat serum, plasma and other biological fluids

ELISA kit for Mouse Uromodulin-like 1

EK3737 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Uromodulin-like 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Umodl1/ Uromodulin-like 1 ELISA Kit

E1564Mo 1 Kit
EUR 632

Mouse Uromodulin- like 1, Umodl1 ELISA KIT

ELI-17841m 96 Tests
EUR 865

Mouse Uromodulin-Like 1 (UMODL1) ELISA Kit

abx555573-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.

Guinea pig Uromodulin ELISA kit

E05U0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Uromodulin ELISA kit

E05U0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Uromodulin ELISA kit

E05U0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Uromodulin

EK4469 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Uromodulin

EK4471 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

Umodl1 ELISA Kit| Mouse Uromodulin-like 1 ELISA Kit

EF016476 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Mouse UMOD shRNA Plasmid

20-abx973312
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UMOD Recombinant Protein (Mouse)

RP183092 100 ug Ask for price

Human Uromodulin DuoSet ELISA

55R-2264 5 x 96 wells
EUR 702
Description: ELISA kit for detection of Human Uromodulin

Human Uromodulin

7-03772 2µg Ask for price

Human Uromodulin

7-03773 10µg Ask for price

Human Uromodulin

7-03774 1mg Ask for price

Canine Uromodulin

7-03775 2µg Ask for price

Canine Uromodulin

7-03776 10µg Ask for price

Canine Uromodulin

7-03777 1mg Ask for price

Uromodulin antibody

70R-50530 100 ul
EUR 244
Description: Purified Polyclonal Uromodulin antibody

Uromodulin antibody

70R-5800 50 ug
EUR 467
Description: Rabbit polyclonal Uromodulin antibody raised against the middle region of UMOD

Uromodulin Enzyme

20-abx073760
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

UMOD antibody

70R-21166 50 ul
EUR 435
Description: Rabbit polyclonal UMOD antibody

UMOD Antibody

32498-100ul 100ul
EUR 252

UMOD Antibody

1-CSB-PA060042
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

UMOD Antibody

DF6692 200ul
EUR 304
Description: UMOD Antibody detects endogenous levels of total UMOD.

UMOD antibody

70R-8504 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UMOD antibody

UMOD Antibody

1-CSB-PA025616GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

UMOD siRNA

20-abx905951
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UMOD siRNA

20-abx939015
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UMOD siRNA

20-abx939016
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UMOD Antibody

ABD6692 100 ug
EUR 438

Human Uromodulin-Like 1 (UMODL1) ELISA Kit

abx555852-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.

Human Uromodulin- like 1, UMODL1 ELISA KIT

ELI-39866h 96 Tests
EUR 824

Umod ORF Vector (Mouse) (pORF)

ORF061032 1.0 ug DNA
EUR 506

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Uromodulin Blocking Peptide

33R-6556 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UMOD antibody, catalog no. 70R-5800

Uromodulin Protein (OVA)

20-abx165606
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dog Uromodulin Enzyme

20-abx073755
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Pig Uromodulin Enzyme

20-abx073830
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Cat Uromodulin Enzyme

20-abx073947
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0.1 mg
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Uromodulin Blocking Peptide

20-abx063405
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

anti- Uromodulin antibody

FNab09294 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:500
  • IP: 1:200-1:2000
  • Immunogen: uromodulin
  • Uniprot ID: P07911
Description: Antibody raised against Uromodulin

Anti-Uromodulin antibody

PAab09294 100 ug
EUR 386

Anti-Uromodulin antibody

STJ72847 100 µg
EUR 359

UMOD Blocking Peptide

33R-7383 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UMOD antibody, catalog no. 70R-8504

UMOD Blocking Peptide

DF6692-BP 1mg
EUR 195

UMOD Conjugated Antibody

C32498 100ul
EUR 397

UMOD cloning plasmid

CSB-CL025616HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1836
  • Sequence: atggggcagccatctctgacttggatgctgatggtggtggtggcctcttggttcatcacaactgcagccactgacacctcagaagcaagatggtgctctgaatgtcacagcaatgccacctgcacggaggatgaggccgttacgacgtgcacctgtcaggagggcttcaccggcg
  • Show more
Description: A cloning plasmid for the UMOD gene.

UMOD Rabbit pAb

A1920-100ul 100 ul
EUR 308

UMOD Rabbit pAb

A1920-200ul 200 ul
EUR 459

UMOD Rabbit pAb

A1920-20ul 20 ul
EUR 183

UMOD Rabbit pAb

A1920-50ul 50 ul
EUR 223

Anti-UMOD antibody

STJ26043 100 µl
EUR 277
Description: The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Umod sgRNA CRISPR Lentivector set (Mouse)

K4000601 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Polyclonal UMOD Antibody (Center)

APR03934G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD (Center). This antibody is tested and proven to work in the following applications:

Rat UMOD shRNA Plasmid

20-abx984809
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human UMOD shRNA Plasmid

20-abx955040
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UMOD Recombinant Protein (Rat)

RP235856 100 ug Ask for price

UMOD Recombinant Protein (Human)

RP033967 100 ug Ask for price

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Mouse Uromodulin Like Protein 1 (UMODL1) Protein

20-abx165944
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Recombinant Mouse Uromodulin Protein, His, Yeast-100ug

QP9459-ye-100ug 100ug
EUR 571

Recombinant Mouse Uromodulin Protein, His, Yeast-10ug

QP9459-ye-10ug 10ug
EUR 272

Recombinant Mouse Uromodulin Protein, His, Yeast-1mg

QP9459-ye-1mg 1mg
EUR 2303

Recombinant Mouse Uromodulin Protein, His, Yeast-200ug

QP9459-ye-200ug 200ug
EUR 898

Recombinant Mouse Uromodulin Protein, His, Yeast-500ug

QP9459-ye-500ug 500ug
EUR 1505

Recombinant Mouse Uromodulin Protein, His, Yeast-50ug

QP9459-ye-50ug 50ug
EUR 354

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Umod sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4000602 1.0 ug DNA
EUR 154

Umod sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4000603 1.0 ug DNA
EUR 154

Umod sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4000604 1.0 ug DNA
EUR 154

UMOD Protein Vector (Mouse) (pPB-C-His)

PV244126 500 ng
EUR 603

UMOD Protein Vector (Mouse) (pPB-N-His)

PV244127 500 ng
EUR 603

UMOD Protein Vector (Mouse) (pPM-C-HA)

PV244128 500 ng
EUR 603

UMOD Protein Vector (Mouse) (pPM-C-His)

PV244129 500 ng
EUR 603