Mouse UMOD(Uromodulin) ELISA Kit
To Order Contact us now:
Mouse Uromodulin (UMOD) ELISA Kit |
RDR-UMOD-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Uromodulin (UMOD) ELISA Kit |
RDR-UMOD-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Uromodulin (UMOD) ELISA Kit |
RD-UMOD-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Uromodulin (UMOD) ELISA Kit |
RD-UMOD-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Uromodulin (UMOD) ELISA Kit |
DLR-UMOD-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids. |
Human Uromodulin (UMOD) ELISA Kit |
DLR-UMOD-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids. |
Rat Uromodulin (UMOD) ELISA Kit |
DLR-UMOD-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids. |
Rat Uromodulin (UMOD) ELISA Kit |
DLR-UMOD-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids. |
Human Uromodulin (UMOD) ELISA Kit |
RDR-UMOD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Uromodulin (UMOD) ELISA Kit |
RDR-UMOD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Uromodulin (UMOD) ELISA Kit |
RDR-UMOD-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Uromodulin (UMOD) ELISA Kit |
RDR-UMOD-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Uromodulin (UMOD) ELISA Kit |
RD-UMOD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Uromodulin (UMOD) ELISA Kit |
RD-UMOD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Uromodulin (UMOD) ELISA Kit |
RD-UMOD-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Uromodulin (UMOD) ELISA Kit |
RD-UMOD-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Mouse Uromodulin (UMOD) ELISA Kit |
abx575290-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse Umod/ Uromodulin ELISA Kit |
E1563Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Uromodulin (UMOD) ELISA Kit |
20-abx154835 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Uromodulin (UMOD) ELISA Kit |
abx254464-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse Uromodulin(UMOD) ELISA kit |
CSB-EL025616MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Uromodulin (UMOD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Uromodulin(UMOD) ELISA kit |
1-CSB-EL025616MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Uromodulin(UMOD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Uromodulin ELISA Kit (UMOD) |
RK03267 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Uromodulin (UMOD) ELISA Kit |
SEG918Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Mouse Uromodulin (UMOD) ELISA Kit |
SEG918Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Mouse Uromodulin (UMOD) ELISA Kit |
SEG918Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Mouse Uromodulin (UMOD) ELISA Kit |
SEG918Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Mouse Uromodulin (UMOD) ELISA Kit |
4-SEG918Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP
- Uromucoid, Tamm-Horsfall Glycoprotein
- Tamm-Horsfall urinary glycoprotein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Uromodulin (Umod) |
1-CSB-YP025616MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 64.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Uromodulin(Umod),partial expressed in Yeast |
ELISA kit for Mouse UMOD (Uromodulin) |
ELK6195 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD
- Show more
|
Description: A sandwich ELISA kit for detection of Uromodulin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Uromodulin (UMOD) |
KTE70036-48T |
Abbkine |
48T |
EUR 332 |
- The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Uromodulin (UMOD) |
KTE70036-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Uromodulin (UMOD) |
KTE70036-96T |
Abbkine |
96T |
EUR 539 |
- The olfactory system provides a unique model for developmental neurobiology. Olfactorin is a secreted modular protein containing several domains typically present in extracellular matrix proteins. During embryonic development expression of the Umodl1
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Uromodulin (UMOD) CLIA Kit |
20-abx495330 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Uromodulin (UMOD) Protein |
20-abx168347 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cow Uromodulin (UMOD) ELISA Kit |
abx519957-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Dog Uromodulin (UMOD) ELISA Kit |
abx519958-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Uromodulin (UMOD) ELISA Kit |
abx575289-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Uromodulin (UMOD) ELISA Kit |
abx575301-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat Umod/ Uromodulin ELISA Kit |
E1022Ra |
Sunlong |
1 Kit |
EUR 571 |
Human UMOD/ Uromodulin ELISA Kit |
E2642Hu |
Sunlong |
1 Kit |
EUR 571 |
Human UMOD(Uromodulin) ELISA Kit |
EH2197 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P07911
- Alias: UMOD/ADMCKD2/FJHN/HNFJ/MCKD2/THGP/THP/UMOD/Uromucoid/ADMCKD2/FJHN/HNFJ/HNFJ1/MCKD2/Tamm-Horsfall glycoprotein/THGP/THP/uromodulin(uromucoid, Tamm-Horsfall glycoprotein)/uromucoid/Tamm-Horsfall
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Rat Uromodulin (UMOD) ELISA Kit |
20-abx156212 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Uromodulin (UMOD) ELISA Kit |
20-abx153446 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Uromodulin (UMOD) ELISA Kit |
abx256048-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Uromodulin (UMOD) ELISA Kit |
20-abx258401 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Uromodulin (UMOD) ELISA Kit |
abx251538-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Uromodulin (UMOD) ELISA Kit |
abx253270-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat Uromodulin(UMOD) ELISA kit |
CSB-EL025616RA-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Uromodulin (UMOD) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Uromodulin(UMOD) ELISA kit |
1-CSB-EL025616RA |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Uromodulin(UMOD) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Uromodulin ELISA Kit (UMOD) |
RK02479 |
Abclonal |
96 Tests |
EUR 521 |
Rat Uromodulin ELISA Kit (UMOD) |
RK04012 |
Abclonal |
96 Tests |
EUR 521 |
Human Uromodulin (UMOD) ELISA Kit |
SEG918Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Human Uromodulin (UMOD) ELISA Kit |
SEG918Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Human Uromodulin (UMOD) ELISA Kit |
SEG918Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Human Uromodulin (UMOD) ELISA Kit |
SEG918Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Human Uromodulin (UMOD) ELISA Kit |
4-SEG918Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP
- Uromucoid, Tamm-Horsfall Glycoprotein
- Tamm-Horsfall urinary glycoprotein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Uromodulin (UMOD) ELISA Kit |
SEG918Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Rat Uromodulin (UMOD) ELISA Kit |
SEG918Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Rat Uromodulin (UMOD) ELISA Kit |
SEG918Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Rat Uromodulin (UMOD) ELISA Kit |
SEG918Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
Rat Uromodulin (UMOD) ELISA Kit |
4-SEG918Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP
- Uromucoid, Tamm-Horsfall Glycoprotein
- Tamm-Horsfall urinary glycoprotein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species. |
Uromodulin (UMOD) Antibody |
20-abx116546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Uromodulin (UMOD) Antibody |
20-abx129707 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uromodulin (UMOD) Antibody |
20-abx001568 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Uromodulin (UMOD) Antibody |
20-abx100690 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uromodulin (UMOD) Antibody |
20-abx100691 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uromodulin (UMOD) Antibody |
20-abx100692 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uromodulin (UMOD) Antibody |
20-abx008590 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Uromodulin (UMOD) Antibody |
20-abx175043 |
Abbexa |
|
|
|
Uromodulin (UMOD) Antibody |
20-abx323479 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Uromodulin (UMOD) Antibody |
abx433429-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Uromodulin (UMOD) Antibody |
abx433430-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Uromodulin (UMOD) Antibody |
abx239294-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Uromodulin (UMOD) Antibody |
20-abx178822 |
Abbexa |
|
|
|
Uromodulin (UMOD) Antibody |
20-abx178823 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Recombinant Uromodulin (UMOD) |
4-RPG918Ca01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q862Z3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 13.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Dog Uromodulin expressed in: E.coli |
Recombinant Uromodulin (UMOD) |
4-RPG918Hu01 |
Cloud-Clone |
-
EUR 504.99
-
EUR 238.00
-
EUR 1618.72
-
EUR 606.24
-
EUR 1112.48
-
EUR 401.00
-
EUR 3896.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P07911
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01%skl, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.8kDa
- Isoelectric Point: 7.1
|
Description: Recombinant Human Uromodulin expressed in: E.coli |
Recombinant Uromodulin (UMOD) |
4-RPG918Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q91X17
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 60.8kDa
- Isoelectric Point: 6.4
|
Description: Recombinant Mouse Uromodulin expressed in: E.coli |
Recombinant Uromodulin (UMOD) |
4-RPG918Ra01 |
Cloud-Clone |
-
EUR 522.91
-
EUR 243.00
-
EUR 1685.92
-
EUR 628.64
-
EUR 1157.28
-
EUR 413.00
-
EUR 4064.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P27590
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Uromodulin expressed in: E.coli |
Human Uromodulin/umod PicoKine ELISA Kit |
EK1690 |
BosterBio |
96 wells |
EUR 455 |
Description: For quantitative detection of human Uromodulin in cell culture supernates, serum and plasma (heparin). |
ELISA kit for Human UMOD (Uromodulin) |
ELK3807 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD
- Show more
|
Description: A sandwich ELISA kit for detection of Uromodulin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat UMOD (Uromodulin) |
ELK6138 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uromodulin (UMOD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uromodulin (UMOD
- Show more
|
Description: A sandwich ELISA kit for detection of Uromodulin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat Uromodulin (UMOD) |
KTE100854-48T |
Abbkine |
48T |
EUR 332 |
- Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Uromodulin (UMOD) |
KTE100854-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Uromodulin (UMOD) |
KTE100854-96T |
Abbkine |
96T |
EUR 539 |
- Uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Uromodulin (UMOD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Uromodulin (UMOD) Polyclonal Antibody (Mouse) |
4-PAG918Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu335~Ser590)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD) |
Human Uromodulin (UMOD) CLIA Kit |
20-abx490738 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Uromodulin (UMOD) CLIA Kit |
20-abx495329 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Uromodulin (UMOD) CLIA Kit |
20-abx495331 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Uromodulin (UMOD) Protein |
20-abx069612 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2179.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Uromodulin (UMOD) Protein |
20-abx069613 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2277.00
-
EUR 871.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dog Uromodulin (UMOD) Protein |
20-abx069614 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Uromodulin (UMOD) Antibody Pair |
20-abx370002 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Uromodulin (UMOD) Antibody (Biotin) |
20-abx271676 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1469.00
-
EUR 690.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Uromodulin (UMOD) Antibody (Biotin) |
20-abx272397 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
OVA Conjugated Uromodulin (UMOD) |
4-CPG918Hu21 |
Cloud-Clone |
-
EUR 368.80
-
EUR 202.00
-
EUR 1108.00
-
EUR 436.00
-
EUR 772.00
-
EUR 310.00
-
EUR 2620.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P07911
- Buffer composition: PBS, pH 7.4.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Human Uromodulin expressed in: chemical synthesis |
UMOD Uromodulin Human protein |
PROTP07911 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Uromodulin Human Native protein produced from Human Urine, is a glycosylated polypeptide chain containing 590 amino acids, having a total Mw of 64.25 kDa (excluding glycosylation). |
High Sensitive Human Uromodulin (UMOD) ELISA Kit |
HEG918Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
High Sensitive Human Uromodulin (UMOD) ELISA Kit |
HEG918Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
High Sensitive Human Uromodulin (UMOD) ELISA Kit |
HEG918Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
High Sensitive Human Uromodulin (UMOD) ELISA Kit |
HEG918Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Uromodulin (UMOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uromodulin (UMOD) in serum, plasma, urine and other biological fluids. |
High Sensitive Human Uromodulin (UMOD) ELISA Kit |
4-HEG918Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Uromodulin elisa. Alternative names of the recognized antigen: THP
- Uromucoid, Tamm-Horsfall Glycoprotein
- Tamm-Horsfall urinary glycoprotein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Uromodulin (UMOD) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species. |
Uromodulin (UMOD) Polyclonal Antibody (Mouse), APC |
4-PAG918Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu335~Ser590)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with APC. |
Uromodulin (UMOD) Polyclonal Antibody (Mouse), Biotinylated |
4-PAG918Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu335~Ser590)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with Biotin. |
Uromodulin (UMOD) Polyclonal Antibody (Mouse), Cy3 |
4-PAG918Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu335~Ser590)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with Cy3. |
Uromodulin (UMOD) Polyclonal Antibody (Mouse), FITC |
4-PAG918Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu335~Ser590)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with FITC. |
Uromodulin (UMOD) Polyclonal Antibody (Mouse), HRP |
4-PAG918Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu335~Ser590)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with HRP. |
Uromodulin (UMOD) Polyclonal Antibody (Mouse), PE |
4-PAG918Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu335~Ser590)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with PE. |
Polyclonal UMOD / Uromodulin Antibody (Val378) |
APR03149G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD / Uromodulin (Val378). This antibody is tested and proven to work in the following applications: |
Uromodulin (UMOD) Polyclonal Antibody (Dog) |
4-PAG918Ca01 |
Cloud-Clone |
-
EUR 268.00
-
EUR 2840.00
-
EUR 700.00
-
EUR 340.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Arg32~Glu151)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD) |
Uromodulin (UMOD) Polyclonal Antibody (Rat) |
4-PAG918Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu30~Glu150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD) |
Uromodulin (UMOD) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAG918Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu335~Ser590)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uromodulin (UMOD). This antibody is labeled with APC-Cy7. |
Uromodulin (UMOD) Polyclonal Antibody (Dog), APC |
4-PAG918Ca01-APC |
Cloud-Clone |
-
EUR 377.00
-
EUR 3725.00
-
EUR 1025.00
-
EUR 485.00
-
EUR 233.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Arg32~Glu151)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with APC. |
Uromodulin (UMOD) Polyclonal Antibody (Dog), Biotinylated |
4-PAG918Ca01-Biotin |
Cloud-Clone |
-
EUR 334.00
-
EUR 2790.00
-
EUR 810.00
-
EUR 414.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Arg32~Glu151)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with Biotin. |
Uromodulin (UMOD) Polyclonal Antibody (Dog), Cy3 |
4-PAG918Ca01-Cy3 |
Cloud-Clone |
-
EUR 461.00
-
EUR 4925.00
-
EUR 1325.00
-
EUR 605.00
-
EUR 269.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Arg32~Glu151)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with Cy3. |
Uromodulin (UMOD) Polyclonal Antibody (Dog), FITC |
4-PAG918Ca01-FITC |
Cloud-Clone |
-
EUR 321.00
-
EUR 3000.00
-
EUR 840.00
-
EUR 408.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Arg32~Glu151)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with FITC. |
Uromodulin (UMOD) Polyclonal Antibody (Dog), HRP |
4-PAG918Ca01-HRP |
Cloud-Clone |
-
EUR 343.00
-
EUR 3245.00
-
EUR 905.00
-
EUR 437.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Arg32~Glu151)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with HRP. |
Uromodulin (UMOD) Polyclonal Antibody (Dog), PE |
4-PAG918Ca01-PE |
Cloud-Clone |
-
EUR 321.00
-
EUR 3000.00
-
EUR 840.00
-
EUR 408.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Arg32~Glu151)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with PE. |
Uromodulin (UMOD) Polyclonal Antibody (Human, Pig) |
4-PAG918Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu334~Ser589)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD) |
Uromodulin (UMOD) Polyclonal Antibody (Rat), APC |
4-PAG918Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu30~Glu150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with APC. |
Uromodulin (UMOD) Polyclonal Antibody (Rat), Biotinylated |
4-PAG918Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu30~Glu150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with Biotin. |
Uromodulin (UMOD) Polyclonal Antibody (Rat), Cy3 |
4-PAG918Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu30~Glu150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with Cy3. |
Uromodulin (UMOD) Polyclonal Antibody (Rat), FITC |
4-PAG918Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu30~Glu150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with FITC. |
Uromodulin (UMOD) Polyclonal Antibody (Rat), HRP |
4-PAG918Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu30~Glu150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with HRP. |
Uromodulin (UMOD) Polyclonal Antibody (Rat), PE |
4-PAG918Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu30~Glu150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with PE. |
Uromodulin (UMOD) Polyclonal Antibody (Dog), APC-Cy7 |
4-PAG918Ca01-APC-Cy7 |
Cloud-Clone |
-
EUR 634.00
-
EUR 7330.00
-
EUR 1930.00
-
EUR 850.00
-
EUR 346.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Arg32~Glu151)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with APC-Cy7. |
Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), APC |
4-PAG918Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu334~Ser589)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with APC. |
Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAG918Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu334~Ser589)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with Biotin. |
Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAG918Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu334~Ser589)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with Cy3. |
Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), FITC |
4-PAG918Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu334~Ser589)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with FITC. |
Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), HRP |
4-PAG918Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu334~Ser589)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with HRP. |
Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), PE |
4-PAG918Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu334~Ser589)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with PE. |
Uromodulin (UMOD) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAG918Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu30~Glu150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uromodulin (UMOD). This antibody is labeled with APC-Cy7. |
Mouse Uromodulin ELISA kit |
E03U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Uromodulin ELISA kit |
E03U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Uromodulin ELISA kit |
E03U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monoclonal UMOD / Uromodulin Antibody (clone 10.32), Clone: 10.32 |
AMM01787G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human UMOD / Uromodulin (clone 10.32). The antibodies are raised in Mouse and are from clone 10.32. This antibody is applicable in IHC-P, IF, IHC-Fr |
Uromodulin (UMOD) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAG918Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UMOD (Glu334~Ser589)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Uromodulin (UMOD). This antibody is labeled with APC-Cy7. |
ELISA kit for Mouse Uromodulin |
EK4470 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids. |
UMOD ELISA Kit (Mouse) (OKAN05949) |
OKAN05949 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL |
UMOD ELISA Kit (Mouse) (OKCD02971) |
OKCD02971 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Uromodulin: Functions in biogenesis and organization of the apical membrane of epithelial cells of the thick ascending limb of Henle's loop (TALH), where it promotes formation of complex filamentous gel-like structure that may play a role in the water barrier permeability. May serve as a receptor for binding and endocytosis of cytokines (IL-1, IL-2) and TNF. Facilitates neutrophil migration across renal epithelia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL |
UMOD ELISA Kit (Mouse) (OKEH07203) |
OKEH07203 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Uromodulin: Functions in biogenesis and organization of the apical membrane of epithelial cells of the thick ascending limb of Henle's loop (TALH), where it promotes formation of complex filamentous gel-like structure that may play a role in the water barrier permeability. May serve as a receptor for binding and endocytosis of cytokines (IL-1, IL-2) and TNF. Facilitates neutrophil migration across renal epithelia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.4 ng/mL |
Human Uromodulin ELISA kit |
E01U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Uromodulin ELISA kit |
E01U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Uromodulin ELISA kit |
E01U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Uromodulin ELISA kit |
E02U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Uromodulin ELISA kit |
E02U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Uromodulin ELISA kit |
E02U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Uromodulin ELISA kit |
E04U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Uromodulin ELISA kit |
E04U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Uromodulin ELISA kit |
E04U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Uromodulin ELISA kit |
E08U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Uromodulin ELISA kit |
E08U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Uromodulin ELISA kit |
E08U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Uromodulin ELISA kit |
E07U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Uromodulin ELISA kit |
E07U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Uromodulin ELISA kit |
E07U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Uromodulin ELISA kit |
E06U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Uromodulin ELISA kit |
E06U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Uromodulin ELISA kit |
E06U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Uromodulin ELISA kit |
E09U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Uromodulin ELISA kit |
E09U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Uromodulin ELISA kit |
E09U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat UMOD ELISA Kit |
STJ150397 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of THP in Rat serum, plasma and other biological fluids |
Mouse Uromodulin-Like 1 (UMODL1) ELISA Kit |
abx555573-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 1-3 weeks.
|
ELISA kit for Mouse Uromodulin-like 1 |
EK3737 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Uromodulin-like 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Umodl1/ Uromodulin-like 1 ELISA Kit |
E1564Mo |
Sunlong |
1 Kit |
EUR 632 |
Guinea pig Uromodulin ELISA kit |
E05U0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Uromodulin ELISA kit |
E05U0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Uromodulin ELISA kit |
E05U0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Uromodulin |
EK4469 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Rat Uromodulin |
EK4471 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Uromodulin in samples from serum, plasma, tissue homogenates and other biological fluids. |
UMOD ELISA Kit (Human) (OKAN05267) |
OKAN05267 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.263 ng/mL |
UMOD ELISA Kit (Rat) (OKAN05451) |
OKAN05451 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: mutation of the human homolog is associated with medullary cystic kidney disease 2 and familial juvenile hyperuricaemic nephropathy [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL |
UMOD ELISA Kit (Human) (OKCD09003) |
OKCD09003 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes uromodulin, the most abundant protein in normal urine. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the lo;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.263ng/mL |
UMOD ELISA Kit (Rat) (OKCD09004) |
OKCD09004 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: mutation of the human homolog is associated with medullary cystic kidney disease 2 and familial juvenile hyperuricaemic nephropathy.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.067ng/mL |
UMOD ELISA Kit (Rat) (OKEH03497) |
OKEH03497 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Uromodulin: Functions in biogenesis and organization of the apical membrane of epithelial cells of the thick ascending limb of Henle's loop (TALH), where it promotes formation of complex filamentous gel-like structure that may play a role in the water barrier permeability. May serve as a receptor for binding and endocytosis of cytokines (IL-1, IL-2) and TNF. Facilitates neutrophil migration across renal epithelia.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
UMOD ELISA Kit (Human) (OKBB01182) |
OKBB01182 |
Aviva Systems Biology |
96 Wells |
EUR 544 |
Description: Description of target: The Tamm–Horsfall glycoprotein (THP), also known as uromodulin, is a glycoprotein that in humans is encoded by the UMOD gene. The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Umodl1 ELISA Kit| Mouse Uromodulin-like 1 ELISA Kit |
EF016476 |
Lifescience Market |
96 Tests |
EUR 689 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Mouse UMOD shRNA Plasmid |
20-abx973312 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UMOD Recombinant Protein (Mouse) |
RP183092 |
ABM |
100 ug |
Ask for price |
Human Uromodulin DuoSet ELISA |
55R-2264 |
Fitzgerald |
5 x 96 wells |
EUR 702 |
Description: ELISA kit for detection of Human Uromodulin |
Uromodulin Enzyme |
20-abx073760 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Uromodulin antibody |
70R-50530 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal Uromodulin antibody |
Uromodulin antibody |
70R-5800 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Uromodulin antibody raised against the middle region of UMOD |
UMOD siRNA |
20-abx905951 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UMOD siRNA |
20-abx939015 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UMOD siRNA |
20-abx939016 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UMOD antibody |
70R-21166 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UMOD antibody |
UMOD antibody |
70R-8504 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal UMOD antibody |
UMOD Antibody |
32498-100ul |
SAB |
100ul |
EUR 252 |
UMOD Antibody |
DF6692 |
Affbiotech |
200ul |
EUR 304 |
Description: UMOD Antibody detects endogenous levels of total UMOD. |
UMOD Antibody |
1-CSB-PA060042 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
UMOD Antibody |
1-CSB-PA025616GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Umod ORF Vector (Mouse) (pORF) |
ORF061032 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Uromodulin-Like 1 (UMODL1) ELISA Kit |
abx555852-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 1-3 weeks.
|
UMOD High Sensitivity ELISA Kit (Human) (OKCD01383) |
OKCD01383 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Uromodulin: Functions in biogenesis and organization of the apical membrane of epithelial cells of the thick ascending limb of Henle's loop (TALH), where it promotes formation of complex filamentous gel-like structure that may play a role in the water barrier permeability (Probable). May serve as a receptor for binding and endocytosis of cytokines (IL-1, IL-2) and TNF. Facilitates neutrophil migration across renal epithelia.Curated;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.3 pg/mL |
UMOD ELISA Kit (Human) : 96 Wells (OKEH01613) |
OKEH01613 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
anti- Uromodulin antibody |
FNab09294 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:500
- IP: 1:200-1:2000
- Immunogen: uromodulin
- Uniprot ID: P07911
|
Description: Antibody raised against Uromodulin |
Dog Uromodulin Enzyme |
20-abx073755 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Pig Uromodulin Enzyme |
20-abx073830 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Cat Uromodulin Enzyme |
20-abx073947 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Uromodulin Protein (OVA) |
20-abx165606 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 384.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uromodulin Blocking Peptide |
20-abx063405 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Uromodulin Blocking Peptide |
33R-6556 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UMOD antibody, catalog no. 70R-5800 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
UMOD Conjugated Antibody |
C32498 |
SAB |
100ul |
EUR 397 |
UMOD cloning plasmid |
CSB-CL025616HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1836
- Sequence: atggggcagccatctctgacttggatgctgatggtggtggtggcctcttggttcatcacaactgcagccactgacacctcagaagcaagatggtgctctgaatgtcacagcaatgccacctgcacggaggatgaggccgttacgacgtgcacctgtcaggagggcttcaccggcg
- Show more
|
Description: A cloning plasmid for the UMOD gene. |
UMOD Rabbit pAb |
A1920-100ul |
Abclonal |
100 ul |
EUR 308 |
UMOD Rabbit pAb |
A1920-200ul |
Abclonal |
200 ul |
EUR 459 |
UMOD Rabbit pAb |
A1920-20ul |
Abclonal |
20 ul |
EUR 183 |
UMOD Rabbit pAb |
A1920-50ul |
Abclonal |
50 ul |
EUR 223 |
UMOD Blocking Peptide |
33R-7383 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UMOD antibody, catalog no. 70R-8504 |
UMOD Blocking Peptide |
DF6692-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-UMOD antibody |
STJ26043 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Umod sgRNA CRISPR Lentivector set (Mouse) |
K4000601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Polyclonal UMOD Antibody (Center) |
APR03934G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD (Center). This antibody is tested and proven to work in the following applications: |
Rat UMOD shRNA Plasmid |
20-abx984809 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human UMOD shRNA Plasmid |
20-abx955040 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UMOD Recombinant Protein (Human) |
RP033967 |
ABM |
100 ug |
Ask for price |
UMOD Recombinant Protein (Rat) |
RP235856 |
ABM |
100 ug |
Ask for price |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Mouse Uromodulin Like Protein 1 (UMODL1) Protein |
20-abx165944 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Recombinant Mouse Uromodulin Protein, His, Yeast-100ug |
QP9459-ye-100ug |
EnQuireBio |
100ug |
EUR 571 |
Recombinant Mouse Uromodulin Protein, His, Yeast-10ug |
QP9459-ye-10ug |
EnQuireBio |
10ug |
EUR 272 |
Recombinant Mouse Uromodulin Protein, His, Yeast-1mg |
QP9459-ye-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Mouse Uromodulin Protein, His, Yeast-200ug |
QP9459-ye-200ug |
EnQuireBio |
200ug |
EUR 898 |
Recombinant Mouse Uromodulin Protein, His, Yeast-500ug |
QP9459-ye-500ug |
EnQuireBio |
500ug |
EUR 1505 |
Recombinant Mouse Uromodulin Protein, His, Yeast-50ug |
QP9459-ye-50ug |
EnQuireBio |
50ug |
EUR 354 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|