Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit

Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit

To Order Contact us now: 

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
RD-PA2G4-Hu-96Tests 96 Tests
EUR 783
Human Proliferation Associated Protein 2G4 (PA2G4)ELISA kit
201-12-2522 96 tests
EUR 440
  • This Proliferation Associated Protein 2G4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
20-abx152617
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Proliferation-associated protein 2G4 (PA2G4) ELISA Kit
abx251224-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human PA2G4/ Proliferation-associated protein 2G4 ELISA Kit
E1856Hu 1 Kit
EUR 571
Human PA2G4(Proliferation-associated protein 2G4) ELISA Kit
EH1906 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9UQ80
  • Alias: PA2G4(Proliferation Associated Protein 2G4)/EBP1/HG4-1/Cell cycle protein p38-2G4 homolog/ErbB-3 binding protein 1/ErbB3-binding protein 1/ErbB3-binding protein Ebp1/p38-2G4/proliferation-asso
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Proliferation- associated protein 2G4, PA2G4 ELISA KIT
ELI-05624h 96 Tests
EUR 824
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx351485-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Proliferation Associated Protein 2G4(PA2G4)ELISA Kit
QY-E00297 96T
EUR 361
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
4-SEL980Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Proliferation Associated Protein 2G4 elisa. Alternative names of the recognized antigen: EBP1
  • HG4-1
  • p38-2G4
  • Cell cycle protein p38-2G4 homolog
  • ErbB3-binding protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx004117
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx129266
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx174187
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236092-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236093-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236094-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx325583
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx302879
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Proliferation Associated Protein 2G4 (PA2G4)
4-RPL980Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UQ80
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Proliferation Associated Protein 2G4 expressed in: E.coli
Human Proliferation Associated Protein 2G4 (PA2G4) Protein
20-abx166114
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Pa2g4/ Proliferation-associated protein 2G4 ELISA Kit
E1094Mo 1 Kit
EUR 571
Mouse Proliferation- associated protein 2G4, Pa2g4 ELISA KIT
ELI-05623m 96 Tests
EUR 865
Monkey Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx359300-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx361100-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx362974-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx356055-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Proliferation-associated protein 2G4 (PA2G4) ELISA Kit
abx518287-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat ProlifeRation Associated Protein 2G4(PA2G4)ELISA kit
QY-E10521 96T
EUR 361
Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit
abx197559-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit
20-abx496007
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
E-EL-H0868 1 plate of 96 wells
EUR 534
  • Gentaur's PA2G4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
ELK6144 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Proliferation Associated Protein 2G4 (PA2G4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Proliferation Associated Protein 2G4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-48T 48T
EUR 332
  • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-96T 96T
EUR 539
  • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Proliferation Associated Protein 2G4 (PA2G4) Antibody (HRP)
20-abx312242
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody (FITC)
20-abx312243
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody (Biotin)
20-abx312244
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PA2G4 Proliferation-associated protein 2G4 Human Recombinant Protein
PROTQ9UQ80 Regular: 25ug
EUR 317
Description: PA2G4 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 402 amino acids (1-394 a.a.) and having a molecular mass of 44.8kDa._x000D_ PA2G4 is fused to 8 amino acids His Tag at C-terminus and purified by proprietary chromatographic techniques._x000D_
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human)
4-PAL980Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4)
CLIA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
E-CL-H0601 1 plate of 96 wells
EUR 584
  • Gentaur's PA2G4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant
Proliferation-Associated 2G4, 38 kDa (PA2G4) Antibody
20-abx114707
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC
4-PAL980Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Biotinylated
4-PAL980Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Biotin.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Cy3
4-PAL980Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Cy3.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), FITC
4-PAL980Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with FITC.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), HRP
4-PAL980Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with HRP.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), PE
4-PAL980Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with PE.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC-Cy7
4-PAL980Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC-Cy7.
Proliferation-associated protein 2G4 Protein
20-abx260573
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.
Recombinant Human Proliferation-associated protein 2G4
7-05794 5µg Ask for price
Recombinant Human Proliferation-associated protein 2G4
7-05795 25µg Ask for price
Recombinant Human Proliferation-associated protein 2G4
7-05796 1mg Ask for price
Mouse ProlifeMouseion Associated Protein 2G4(PA2G4)ELISA kit
QY-E21239 96T
EUR 361
Human PA2G4 ELISA Kit
ELA-E1733h 96 Tests
EUR 824
PA2G4 ELISA KIT|Human
EF006020 96 Tests
EUR 689
Human Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit
abx383208-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit
abx390568-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
PA2G4 Recombinant Protein (Human)
RP022390 100 ug Ask for price
Human Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx251699-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human SIPA1L1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit
EH2343 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O43166
  • Alias: SIPA1L1/High-risk human papilloma viruses E6 oncoproteins targeted protein 1(E6-targeted protein 1)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
ELISA kit for Human Signal-induced proliferation-associated 1-like protein 1
EK4726 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human SIPA1L1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E2290Hu 1 Kit
EUR 605
Signal-Induced Proliferation-Associated 1 Antibody
20-abx115563
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
20-abx008008
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025158-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025158-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025159-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025159-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx211049
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
20-abx123090
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
20-abx126551
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx031502-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx031502-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx029202-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx029202-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx237872-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx339802
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx338441
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
abx231714-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Rat Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx256646-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
ELISA kit for Rat Signal-induced proliferation-associated 1-like protein 1
EK4727 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Rat Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E0891Ra 1 Kit
EUR 646
Mouse Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E1349Mo 1 Kit
EUR 632
Mouse Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx520596-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Sipa1l1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit
ER0671 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O35412
  • Alias: Sipa1l1/SPA-1-like protein p1294/Spine-associated Rap GTPase-activating protein(SPAR)/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml
Monoclonal SLC13A5 Antibody (clone 2G4), Clone: 2G4
APR09978G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human SLC13A5 (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E
PA2G4 antibody
20R-1262 100 ug
EUR 377
Description: Rabbit polyclonal PA2G4 antibody
PA2G4 antibody
70R-19083 50 ul
EUR 435
Description: Rabbit polyclonal PA2G4 antibody
PA2G4 Antibody
32814-100ul 100ul
EUR 252
PA2G4 antibody
10R-1280 100 ug
EUR 512
Description: Mouse monoclonal PA2G4 antibody
PA2G4 Antibody
1-CSB-PA891987LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
PA2G4 Antibody
DF4825 200ul
EUR 304
Description: PA2G4 Antibody detects endogenous levels of total PA2G4.
PA2G4 Antibody
DF7311 200ul
EUR 304
Description: PA2G4 Antibody detects endogenous levels of total PA2G4.
PA2G4 Antibody
1-CSB-PA017344GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen affinity purified
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
PA2G4 antibody
70R-8718 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PA2G4 antibody
Pa2g4 antibody
70R-9556 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Pa2g4 antibody
PA2G4 Antibody
1-CSB-PA020199
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
PA2G4 siRNA
20-abx927569
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PA2G4 siRNA
20-abx927570
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PA2G4 Antibody
ABD4825 100 ug
EUR 438
PA2G4 Antibody
ABD7311 100 ug
EUR 438
PA2G4 protein (His tag)
80R-1311 100 ug
EUR 268
Description: Purified recombinant Human PA2G4 protein
PA2G4 Recombinant Protein (Mouse)
RP159827 100 ug Ask for price
PA2G4 Recombinant Protein (Rat)
RP219104 100 ug Ask for price
Human PA2G4 shRNA Plasmid
20-abx953348
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Monoclonal NOS2 / iNOS Antibody (clone 2G4), Clone: 2G4
APR08771G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NOS2 / iNOS (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (HRP)
20-abx337700
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (FITC)
20-abx337701
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (Biotin)
20-abx337702
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
anti-NBL1 (2G4)
LF-MA10205 100 ug
EUR 363
Description: Mouse monoclonal to NBL1
anti-CHD3 (2G4)
LF-MA30407 100 ul
EUR 486
Description: Mouse Monoclonal to CHD3
Anti-MTAP (2G4)
YF-MA10588 100 ug
EUR 363
Description: Mouse monoclonal to MTAP
Anti-SLC13A5 (2G4)
YF-MA11777 100 ug
EUR 363
Description: Mouse monoclonal to SLC13A5
Anti-ALDH3A1 (2G4)
YF-MA11891 100 ug
EUR 363
Description: Mouse monoclonal to ALDH3A1
Anti-TRIM23 (2G4)
YF-MA11982 100 ug
EUR 363
Description: Mouse monoclonal to TRIM23
Anti-RCBTB2 (2G4)
YF-MA12429 100 ug
EUR 363
Description: Mouse monoclonal to RCBTB2
Anti-LAIR1 (2G4)
YF-MA13950 100 ug
EUR 363
Description: Mouse monoclonal to LAIR1
Anti-Smad3 (2G4)
YF-MA14062 100 ug
EUR 363
Description: Mouse monoclonal to Smad3
Anti-Smad4 (2G4)
YF-MA14071 100 ug
EUR 363
Description: Mouse monoclonal to Smad4
Anti-MGAT1 (2G4)
YF-MA14238 200 ul
EUR 363
Description: Mouse monoclonal to MGAT1
Anti-MGAT3 (2G4)
YF-MA14239 100 ug
EUR 363
Description: Mouse monoclonal to MGAT3
Anti-iNOS (2G4)
YF-MA14483 100 ug
EUR 363
Description: Mouse monoclonal to iNOS
Anti-OIF (2G4)
YF-MA14555 100 ug
EUR 363
Description: Mouse monoclonal to OIF
Anti-Eif3a (2G4)
YF-MA16469 100 ug
EUR 363
Description: Mouse monoclonal to Eif3a
Anti-FGFR1OP2 (2G4)
YF-MA18056 100 ug
EUR 363
Description: Mouse monoclonal to FGFR1OP2
Anti-TROY (2G4)
YF-MA18786 100 ug
EUR 363
Description: Mouse monoclonal to TROY
Anti-DHX32 (2G4)
YF-MA18828 100 ug
EUR 363
Description: Mouse monoclonal to DHX32
Anti-CFC1 (2G4)
YF-MA18907 100 ug
EUR 363
Description: Mouse monoclonal to CFC1
Anti-CRMP5 (2G4)
YF-MA18983 100 ug
EUR 363
Description: Mouse monoclonal to CRMP5
Anti-C13orf1 (2G4)
YF-MA19038 100 ug
EUR 363
Description: Mouse monoclonal to C13orf1
Anti-CPNE5 (2G4)
YF-MA19095 50 ug
EUR 363
Description: Mouse monoclonal to CPNE5
Anti-CPNE5 (2G4)
YF-MA19096 200 ul
EUR 363
Description: Mouse monoclonal to CPNE5
Anti-BOULE (2G4)
YF-MA19291 100 ug
EUR 363
Description: Mouse monoclonal to BOULE
Anti-ZSWIM2 (2G4)
YF-MA19939 100 ug
EUR 363
Description: Mouse monoclonal to ZSWIM2
Anti-PFDN4 (2G4)
YF-MA20386 100 ug
EUR 363
Description: Mouse monoclonal to PFDN4
Human A Proliferation inducing ligand ELISA kit
E01A0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human A Proliferation inducing ligand ELISA kit
E01A0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human MKI67/ Proliferation marker protein Ki-67 ELISA Kit
E1597Hu 1 Kit
EUR 563
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
PA2G4 Rabbit pAb
A14037-100ul 100 ul
EUR 308
PA2G4 Rabbit pAb
A14037-200ul 200 ul
EUR 459
PA2G4 Rabbit pAb
A14037-20ul 20 ul
EUR 183
PA2G4 Rabbit pAb
A14037-50ul 50 ul
EUR 223
PA2G4 Blocking Peptide
33R-5182 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 70R-8718
PA2G4 Blocking Peptide
33R-6656 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 20R-1262
Pa2g4 Blocking Peptide
33R-7021 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pa2g4 antibody, catalog no. 70R-9556
PA2G4 cloning plasmid
CSB-CL891987HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgtcgggcgaggacgagcaacaggagcaaactatcgctgaggacctggtcgtgaccaagtataagatggggggcgacatcgccaacagggtacttcggtccttggtggaagcatctagctcaggtgtgtcggtactgagcctgtgtgagaaaggtgatgccatgattatggaag
  • Show more
Description: A cloning plasmid for the PA2G4 gene.
PA2G4 Blocking Peptide
DF4825-BP 1mg
EUR 195
PA2G4 Blocking Peptide
DF7311-BP 1mg
EUR 195
PA2G4 Conjugated Antibody
C32814 100ul
EUR 397
PA2G4 Polyclonal Antibody
A60154 100 µg
EUR 570.55
Description: The best epigenetics products
PA2G4 Rabbit pAb
A5376-100ul 100 ul
EUR 308