Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit
To Order Contact us now:
 ELISA Kit) Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
RD-PA2G4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
ELISA kit) Human Proliferation Associated Protein 2G4 (PA2G4)ELISA kit |
|
201-12-2522 |
SunredBio |
96 tests |
EUR 440 |
- This Proliferation Associated Protein 2G4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
|
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
20-abx152617 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Human Proliferation-associated protein 2G4 (PA2G4) ELISA Kit |
|
abx251224-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 Human PA2G4/ Proliferation-associated protein 2G4 ELISA Kit |
|
E1856Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human PA2G4(Proliferation-associated protein 2G4) ELISA Kit |
|
EH1906 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q9UQ80
- Alias: PA2G4(Proliferation Associated Protein 2G4)/EBP1/HG4-1/Cell cycle protein p38-2G4 homolog/ErbB-3 binding protein 1/ErbB3-binding protein 1/ErbB3-binding protein Ebp1/p38-2G4/proliferation-asso
- Show more
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
 Human Proliferation- associated protein 2G4, PA2G4 ELISA KIT |
|
ELI-05624h |
Lifescience Market |
96 Tests |
EUR 824 |
|
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
abx351485-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
ELISA Kit) Human Proliferation Associated Protein 2G4(PA2G4)ELISA Kit |
|
QY-E00297 |
Qayee Biotechnology |
96T |
EUR 361 |
|
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
SEL980Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids. |
|
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
SEL980Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids. |
|
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
SEL980Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids. |
|
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
SEL980Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids. |
|
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
4-SEL980Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Proliferation Associated Protein 2G4 elisa. Alternative names of the recognized antigen: EBP1
- HG4-1
- p38-2G4
- Cell cycle protein p38-2G4 homolog
- ErbB3-binding protein 1
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Antibody) Proliferation Associated Protein 2G4 (PA2G4) Antibody |
|
20-abx004117 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
|
Proliferation Associated Protein 2G4 (PA2G4) Antibody |
|
20-abx129266 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
|
Proliferation Associated Protein 2G4 (PA2G4) Antibody |
|
20-abx174187 |
Abbexa |
|
|
|
|
|
Proliferation Associated Protein 2G4 (PA2G4) Antibody |
|
abx236092-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
|
Proliferation Associated Protein 2G4 (PA2G4) Antibody |
|
abx236093-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
|
Proliferation Associated Protein 2G4 (PA2G4) Antibody |
|
abx236094-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
|
Proliferation Associated Protein 2G4 (PA2G4) Antibody |
|
20-abx325583 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Proliferation Associated Protein 2G4 (PA2G4) Antibody |
|
20-abx302879 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Recombinant Proliferation Associated Protein 2G4 (PA2G4) |
|
4-RPL980Hu01 |
Cloud-Clone |
-
EUR 483.49
-
EUR 232.00
-
EUR 1538.08
-
EUR 579.36
-
EUR 1058.72
-
EUR 386.00
-
EUR 3695.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UQ80
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 47.4kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Proliferation Associated Protein 2G4 expressed in: E.coli |
 Protein) Human Proliferation Associated Protein 2G4 (PA2G4) Protein |
|
20-abx166114 |
Abbexa |
-
EUR 676.00
-
EUR 272.00
-
EUR 2068.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Mouse Pa2g4/ Proliferation-associated protein 2G4 ELISA Kit |
|
E1094Mo |
Sunlong |
1 Kit |
EUR 571 |
 Mouse Proliferation- associated protein 2G4, Pa2g4 ELISA KIT |
|
ELI-05623m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Monkey Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
abx359300-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
abx361100-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rabbit Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
abx362974-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit |
|
abx356055-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Proliferation-associated protein 2G4 (PA2G4) ELISA Kit |
|
abx518287-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit) Rat ProlifeRation Associated Protein 2G4(PA2G4)ELISA kit |
|
QY-E10521 |
Qayee Biotechnology |
96T |
EUR 361 |
 CLIA Kit) Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit |
|
abx197559-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
|
Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit |
|
20-abx496007 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4) |
|
E-EL-H0868 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PA2G4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant |
|
ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4) |
|
ELK6144 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Proliferation Associated Protein 2G4 (PA2G4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
- Show more
|
|
Description: A sandwich ELISA kit for detection of Proliferation Associated Protein 2G4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4) |
|
KTE61323-48T |
Abbkine |
48T |
EUR 332 |
- PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4) |
|
KTE61323-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4) |
|
KTE61323-96T |
Abbkine |
96T |
EUR 539 |
- PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Antibody (HRP)) Proliferation Associated Protein 2G4 (PA2G4) Antibody (HRP) |
|
20-abx312242 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Proliferation Associated Protein 2G4 (PA2G4) Antibody (FITC) |
|
20-abx312243 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Proliferation Associated Protein 2G4 (PA2G4) Antibody (Biotin) |
|
20-abx312244 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 PA2G4 Proliferation-associated protein 2G4 Human Recombinant Protein |
|
PROTQ9UQ80 |
BosterBio |
Regular: 25ug |
EUR 317 |
|
Description: PA2G4 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 402 amino acids (1-394 a.a.) and having a molecular mass of 44.8kDa._x000D_ PA2G4 is fused to 8 amino acids His Tag at C-terminus and purified by proprietary chromatographic techniques._x000D_ |
 Polyclonal Antibody (Human)) Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human) |
|
4-PAL980Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PA2G4 (Ser2~Asp394)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4) |
) CLIA kit for Human PA2G4 (Proliferation Associated Protein 2G4) |
|
E-CL-H0601 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's PA2G4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
|
Description: A sandwich CLIA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant |
 Antibody) Proliferation-Associated 2G4, 38 kDa (PA2G4) Antibody |
|
20-abx114707 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human), APC) Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC |
|
4-PAL980Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PA2G4 (Ser2~Asp394)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Biotinylated |
|
4-PAL980Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PA2G4 (Ser2~Asp394)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Cy3 |
|
4-PAL980Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PA2G4 (Ser2~Asp394)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), FITC |
|
4-PAL980Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PA2G4 (Ser2~Asp394)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), HRP |
|
4-PAL980Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PA2G4 (Ser2~Asp394)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), PE |
|
4-PAL980Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PA2G4 (Ser2~Asp394)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with PE. |
 Polyclonal Antibody (Human), APC-Cy7) Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAL980Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PA2G4 (Ser2~Asp394)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC-Cy7. |
 Proliferation-associated protein 2G4 Protein |
|
20-abx260573 |
Abbexa |
-
EUR 2861.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Recombinant Human Proliferation-associated protein 2G4 |
|
7-05794 |
CHI Scientific |
5µg |
Ask for price |
|
Recombinant Human Proliferation-associated protein 2G4 |
|
7-05795 |
CHI Scientific |
25µg |
Ask for price |
|
Recombinant Human Proliferation-associated protein 2G4 |
|
7-05796 |
CHI Scientific |
1mg |
Ask for price |
ELISA kit) Mouse ProlifeMouseion Associated Protein 2G4(PA2G4)ELISA kit |
|
QY-E21239 |
Qayee Biotechnology |
96T |
EUR 361 |
 ELISA Kit) Human Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit |
|
abx383208-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit |
|
abx390568-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
) PA2G4 Recombinant Protein (Human) |
|
RP022390 |
ABM |
100 ug |
Ask for price |
 ELISA Kit) Human Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit |
|
abx251699-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human SIPA1L1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit |
|
EH2343 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O43166
- Alias: SIPA1L1/High-risk human papilloma viruses E6 oncoproteins targeted protein 1(E6-targeted protein 1)
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
 ELISA kit for Human Signal-induced proliferation-associated 1-like protein 1 |
|
EK4726 |
SAB |
96 tests |
EUR 603 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
 Human SIPA1L1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit |
|
E2290Hu |
Sunlong |
1 Kit |
EUR 605 |
 Signal-Induced Proliferation-Associated 1 Antibody |
|
20-abx115563 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 Antibody) Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody |
|
20-abx008008 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
 Antibody) Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody |
|
abx025158-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
|
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody |
|
abx025158-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
|
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody |
|
abx025159-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
|
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody |
|
abx025159-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 Antibody) Signal-induced proliferation-associated protein 1 (SIPA1) Antibody |
|
20-abx211049 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody |
|
20-abx123090 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody |
|
20-abx126551 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
|
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody |
|
abx031502-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
|
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody |
|
abx031502-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
|
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody |
|
abx029202-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
|
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody |
|
abx029202-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
|
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody |
|
abx237872-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
|
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody |
|
20-abx339802 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody |
|
20-abx338441 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
|
Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody |
|
abx231714-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit |
|
abx256646-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA kit for Rat Signal-induced proliferation-associated 1-like protein 1 |
|
EK4727 |
SAB |
96 tests |
EUR 603 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
 Rat Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit |
|
E0891Ra |
Sunlong |
1 Kit |
EUR 646 |
 Mouse Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit |
|
E1349Mo |
Sunlong |
1 Kit |
EUR 632 |
 ELISA Kit) Mouse Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit |
|
abx520596-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Sipa1l1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit |
|
ER0671 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O35412
- Alias: Sipa1l1/SPA-1-like protein p1294/Spine-associated Rap GTPase-activating protein(SPAR)/
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml |
, Clone: 2G4) Monoclonal SLC13A5 Antibody (clone 2G4), Clone: 2G4 |
|
APR09978G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A Monoclonal antibody against Human SLC13A5 (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E |
 PA2G4 antibody |
|
20R-1262 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal PA2G4 antibody |
|
PA2G4 antibody |
|
70R-19083 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal PA2G4 antibody |
 PA2G4 Antibody |
|
32814-100ul |
SAB |
100ul |
EUR 252 |
|
PA2G4 antibody |
|
10R-1280 |
Fitzgerald |
100 ug |
EUR 512 |
|
Description: Mouse monoclonal PA2G4 antibody |
|
PA2G4 Antibody |
|
1-CSB-PA891987LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
|
PA2G4 Antibody |
|
DF4825 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PA2G4 Antibody detects endogenous levels of total PA2G4. |
|
PA2G4 Antibody |
|
DF7311 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PA2G4 Antibody detects endogenous levels of total PA2G4. |
|
PA2G4 Antibody |
|
1-CSB-PA017344GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen affinity purified
|
|
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
|
PA2G4 antibody |
|
70R-8718 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal PA2G4 antibody |
 Pa2g4 antibody |
|
70R-9556 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal Pa2g4 antibody |
|
PA2G4 Antibody |
|
1-CSB-PA020199 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
 PA2G4 siRNA |
|
20-abx927569 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
PA2G4 siRNA |
|
20-abx927570 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) PA2G4 protein (His tag) |
|
80R-1311 |
Fitzgerald |
100 ug |
EUR 268 |
|
Description: Purified recombinant Human PA2G4 protein |
) PA2G4 Recombinant Protein (Mouse) |
|
RP159827 |
ABM |
100 ug |
Ask for price |
) PA2G4 Recombinant Protein (Rat) |
|
RP219104 |
ABM |
100 ug |
Ask for price |
 Human PA2G4 shRNA Plasmid |
|
20-abx953348 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
, Clone: 2G4) Monoclonal NOS2 / iNOS Antibody (clone 2G4), Clone: 2G4 |
|
APR08771G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A Monoclonal antibody against Human NOS2 / iNOS (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E |
 Antibody (HRP)) Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (HRP) |
|
20-abx337700 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (FITC) |
|
20-abx337701 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (Biotin) |
|
20-abx337702 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) anti-NBL1 (2G4) |
|
LF-MA10205 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NBL1 |
) anti-CHD3 (2G4) |
|
LF-MA30407 |
Abfrontier |
100 ul |
EUR 486 |
|
Description: Mouse Monoclonal to CHD3 |
) Anti-MTAP (2G4) |
|
YF-MA10588 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to MTAP |
) Anti-SLC13A5 (2G4) |
|
YF-MA11777 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SLC13A5 |
) Anti-ALDH3A1 (2G4) |
|
YF-MA11891 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ALDH3A1 |
) Anti-TRIM23 (2G4) |
|
YF-MA11982 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to TRIM23 |
) Anti-RCBTB2 (2G4) |
|
YF-MA12429 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to RCBTB2 |
) Anti-LAIR1 (2G4) |
|
YF-MA13950 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to LAIR1 |
) Anti-Smad3 (2G4) |
|
YF-MA14062 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Smad3 |
) Anti-Smad4 (2G4) |
|
YF-MA14071 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Smad4 |
) Anti-MGAT1 (2G4) |
|
YF-MA14238 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to MGAT1 |
) Anti-MGAT3 (2G4) |
|
YF-MA14239 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to MGAT3 |
) Anti-iNOS (2G4) |
|
YF-MA14483 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to iNOS |
) Anti-OIF (2G4) |
|
YF-MA14555 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OIF |
) Anti-Eif3a (2G4) |
|
YF-MA16469 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Eif3a |
) Anti-FGFR1OP2 (2G4) |
|
YF-MA18056 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to FGFR1OP2 |
) Anti-TROY (2G4) |
|
YF-MA18786 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to TROY |
) Anti-DHX32 (2G4) |
|
YF-MA18828 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to DHX32 |
) Anti-CFC1 (2G4) |
|
YF-MA18907 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to CFC1 |
) Anti-CRMP5 (2G4) |
|
YF-MA18983 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to CRMP5 |
) Anti-C13orf1 (2G4) |
|
YF-MA19038 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to C13orf1 |
) Anti-CPNE5 (2G4) |
|
YF-MA19095 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse monoclonal to CPNE5 |
|
Anti-CPNE5 (2G4) |
|
YF-MA19096 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to CPNE5 |
) Anti-BOULE (2G4) |
|
YF-MA19291 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to BOULE |
) Anti-ZSWIM2 (2G4) |
|
YF-MA19939 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ZSWIM2 |
) Anti-PFDN4 (2G4) |
|
YF-MA20386 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PFDN4 |
 Human A Proliferation inducing ligand ELISA kit |
|
E01A0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Human A Proliferation inducing ligand ELISA kit |
|
E01A0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human MKI67/ Proliferation marker protein Ki-67 ELISA Kit |
|
E1597Hu |
Sunlong |
1 Kit |
EUR 563 |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 PA2G4 Rabbit pAb |
|
A14037-100ul |
Abclonal |
100 ul |
EUR 308 |
|
PA2G4 Rabbit pAb |
|
A14037-200ul |
Abclonal |
200 ul |
EUR 459 |
|
PA2G4 Rabbit pAb |
|
A14037-20ul |
Abclonal |
20 ul |
EUR 183 |
|
PA2G4 Rabbit pAb |
|
A14037-50ul |
Abclonal |
50 ul |
EUR 223 |
 PA2G4 Blocking Peptide |
|
33R-5182 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 70R-8718 |
|
PA2G4 Blocking Peptide |
|
33R-6656 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 20R-1262 |
 Pa2g4 Blocking Peptide |
|
33R-7021 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pa2g4 antibody, catalog no. 70R-9556 |
 PA2G4 cloning plasmid |
|
CSB-CL891987HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1185
- Sequence: atgtcgggcgaggacgagcaacaggagcaaactatcgctgaggacctggtcgtgaccaagtataagatggggggcgacatcgccaacagggtacttcggtccttggtggaagcatctagctcaggtgtgtcggtactgagcctgtgtgagaaaggtgatgccatgattatggaag
- Show more
|
|
Description: A cloning plasmid for the PA2G4 gene. |
|
PA2G4 Blocking Peptide |
|
DF4825-BP |
Affbiotech |
1mg |
EUR 195 |
|
PA2G4 Blocking Peptide |
|
DF7311-BP |
Affbiotech |
1mg |
EUR 195 |
 PA2G4 Conjugated Antibody |
|
C32814 |
SAB |
100ul |
EUR 397 |
 PA2G4 Polyclonal Antibody |
|
A60154 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
|
PA2G4 Rabbit pAb |
|
A5376-100ul |
Abclonal |
100 ul |
EUR 308 |
Human PA2G4 ELISA Kit 
PA2G4 ELISA KIT|Human