Chem-Carb India

Supplier of Specialty Chemicals, Calcium Binding Channels, Precipitated Silica gel, charcoal stripped, heat-inactivated Serum

Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit

Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit

To Order Contact us now: 

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
RD-PA2G4-Hu-96Tests 96 Tests
EUR 783
Human Proliferation Associated Protein 2G4 (PA2G4)ELISA kit
201-12-2522 96 tests
EUR 440
  • This Proliferation Associated Protein 2G4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
20-abx152617
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Proliferation-associated protein 2G4 (PA2G4) ELISA Kit
abx251224-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human PA2G4/ Proliferation-associated protein 2G4 ELISA Kit
E1856Hu 1 Kit
EUR 571
Human PA2G4(Proliferation-associated protein 2G4) ELISA Kit
EH1906 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9UQ80
  • Alias: PA2G4(Proliferation Associated Protein 2G4)/EBP1/HG4-1/Cell cycle protein p38-2G4 homolog/ErbB-3 binding protein 1/ErbB3-binding protein 1/ErbB3-binding protein Ebp1/p38-2G4/proliferation-asso
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Proliferation- associated protein 2G4, PA2G4 ELISA KIT
ELI-05624h 96 Tests
EUR 824
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx351485-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Proliferation Associated Protein 2G4(PA2G4)ELISA Kit
QY-E00297 96T
EUR 361
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
4-SEL980Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Proliferation Associated Protein 2G4 elisa. Alternative names of the recognized antigen: EBP1
  • HG4-1
  • p38-2G4
  • Cell cycle protein p38-2G4 homolog
  • ErbB3-binding protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx004117
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx129266
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx174187
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236092-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236093-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236094-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx325583
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx302879
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Proliferation Associated Protein 2G4 (PA2G4)
4-RPL980Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UQ80
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Proliferation Associated Protein 2G4 expressed in: E.coli
Human Proliferation Associated Protein 2G4 (PA2G4) Protein
20-abx166114
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Pa2g4/ Proliferation-associated protein 2G4 ELISA Kit
E1094Mo 1 Kit
EUR 571
Mouse Proliferation- associated protein 2G4, Pa2g4 ELISA KIT
ELI-05623m 96 Tests
EUR 865
Monkey Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx359300-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx361100-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx362974-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx356055-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Proliferation-associated protein 2G4 (PA2G4) ELISA Kit
abx518287-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat ProlifeRation Associated Protein 2G4(PA2G4)ELISA kit
QY-E10521 96T
EUR 361
Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit
abx197559-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit
20-abx496007
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
E-EL-H0868 1 plate of 96 wells
EUR 534
  • Gentaur's PA2G4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
ELK6144 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Proliferation Associated Protein 2G4 (PA2G4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Proliferation Associated Protein 2G4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-48T 48T
EUR 332
  • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-96T 96T
EUR 539
  • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Proliferation Associated Protein 2G4 (PA2G4) Antibody (HRP)
20-abx312242
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody (FITC)
20-abx312243
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Antibody (Biotin)
20-abx312244
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PA2G4 Proliferation-associated protein 2G4 Human Recombinant Protein
PROTQ9UQ80 Regular: 25ug
EUR 317
Description: PA2G4 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 402 amino acids (1-394 a.a.) and having a molecular mass of 44.8kDa._x000D_ PA2G4 is fused to 8 amino acids His Tag at C-terminus and purified by proprietary chromatographic techniques._x000D_
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human)
4-PAL980Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4)
CLIA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
E-CL-H0601 1 plate of 96 wells
EUR 584
  • Gentaur's PA2G4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant
Proliferation-Associated 2G4, 38 kDa (PA2G4) Antibody
20-abx114707
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC
4-PAL980Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Biotinylated
4-PAL980Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Biotin.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Cy3
4-PAL980Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Cy3.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), FITC
4-PAL980Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with FITC.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), HRP
4-PAL980Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with HRP.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), PE
4-PAL980Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with PE.
Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC-Cy7
4-PAL980Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC-Cy7.
Proliferation-associated protein 2G4 Protein
20-abx260573
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.
Recombinant Human Proliferation-associated protein 2G4
7-05794 5µg Ask for price
Recombinant Human Proliferation-associated protein 2G4
7-05795 25µg Ask for price
Recombinant Human Proliferation-associated protein 2G4
7-05796 1mg Ask for price
Mouse ProlifeMouseion Associated Protein 2G4(PA2G4)ELISA kit
QY-E21239 96T
EUR 361
Human PA2G4 ELISA Kit
ELA-E1733h 96 Tests
EUR 824
PA2G4 ELISA KIT|Human
EF006020 96 Tests
EUR 689
Human Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit
abx383208-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
PA2G4 ELISA Kit (Human) (OKCD09346)
OKCD09346 96 Wells
EUR 909
Description: Description of target: PA2G4 is an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL
PA2G4 ELISA Kit (Human) (OKEH04697)
OKEH04697 96 Wells
EUR 662
Description: Description of target: This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL
Mouse Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit
abx390568-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
PA2G4 Recombinant Protein (Human)
RP022390 100 ug Ask for price
Human Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx251699-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human SIPA1L1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit
EH2343 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O43166
  • Alias: SIPA1L1/High-risk human papilloma viruses E6 oncoproteins targeted protein 1(E6-targeted protein 1)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
ELISA kit for Human Signal-induced proliferation-associated 1-like protein 1
EK4726 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human SIPA1L1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E2290Hu 1 Kit
EUR 605
Signal-Induced Proliferation-Associated 1 Antibody
20-abx115563
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
20-abx008008
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025158-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025158-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025159-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025159-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx211049
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
20-abx123090
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
20-abx126551
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx031502-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx031502-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx029202-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx029202-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx237872-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx339802
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx338441
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
abx231714-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Rat Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx256646-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
ELISA kit for Rat Signal-induced proliferation-associated 1-like protein 1
EK4727 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Rat Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E0891Ra 1 Kit
EUR 646
Mouse Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E1349Mo 1 Kit
EUR 632
Mouse Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx520596-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Sipa1l1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit
ER0671 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O35412
  • Alias: Sipa1l1/SPA-1-like protein p1294/Spine-associated Rap GTPase-activating protein(SPAR)/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml
Monoclonal SLC13A5 Antibody (clone 2G4), Clone: 2G4
APR09978G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human SLC13A5 (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E
PA2G4 antibody
20R-1262 100 ug
EUR 377
Description: Rabbit polyclonal PA2G4 antibody
PA2G4 antibody
70R-19083 50 ul
EUR 435
Description: Rabbit polyclonal PA2G4 antibody
PA2G4 Antibody
32814-100ul 100ul
EUR 252
PA2G4 antibody
10R-1280 100 ug
EUR 512
Description: Mouse monoclonal PA2G4 antibody
PA2G4 Antibody
1-CSB-PA891987LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
PA2G4 Antibody
DF4825 200ul
EUR 304
Description: PA2G4 Antibody detects endogenous levels of total PA2G4.
PA2G4 Antibody
DF7311 200ul
EUR 304
Description: PA2G4 Antibody detects endogenous levels of total PA2G4.
PA2G4 Antibody
1-CSB-PA017344GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen affinity purified
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
PA2G4 antibody
70R-8718 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PA2G4 antibody
Pa2g4 antibody
70R-9556 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Pa2g4 antibody
PA2G4 Antibody
1-CSB-PA020199
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
PA2G4 siRNA
20-abx927569
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PA2G4 siRNA
20-abx927570
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PA2G4 Antibody
ABD4825 100 ug
EUR 438
PA2G4 Antibody
ABD7311 100 ug
EUR 438
PA2G4 protein (His tag)
80R-1311 100 ug
EUR 268
Description: Purified recombinant Human PA2G4 protein
PA2G4 Recombinant Protein (Mouse)
RP159827 100 ug Ask for price
PA2G4 Recombinant Protein (Rat)
RP219104 100 ug Ask for price
Human PA2G4 shRNA Plasmid
20-abx953348
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Monoclonal NOS2 / iNOS Antibody (clone 2G4), Clone: 2G4
APR08771G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NOS2 / iNOS (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (HRP)
20-abx337700
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (FITC)
20-abx337701
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (Biotin)
20-abx337702
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
anti-NBL1 (2G4)
LF-MA10205 100 ug
EUR 363
Description: Mouse monoclonal to NBL1
anti-CHD3 (2G4)
LF-MA30407 100 ul
EUR 486
Description: Mouse Monoclonal to CHD3
Anti-MTAP (2G4)
YF-MA10588 100 ug
EUR 363
Description: Mouse monoclonal to MTAP
Anti-SLC13A5 (2G4)
YF-MA11777 100 ug
EUR 363
Description: Mouse monoclonal to SLC13A5
Anti-ALDH3A1 (2G4)
YF-MA11891 100 ug
EUR 363
Description: Mouse monoclonal to ALDH3A1
Anti-TRIM23 (2G4)
YF-MA11982 100 ug
EUR 363
Description: Mouse monoclonal to TRIM23
Anti-RCBTB2 (2G4)
YF-MA12429 100 ug
EUR 363
Description: Mouse monoclonal to RCBTB2
Anti-LAIR1 (2G4)
YF-MA13950 100 ug
EUR 363
Description: Mouse monoclonal to LAIR1
Anti-Smad3 (2G4)
YF-MA14062 100 ug
EUR 363
Description: Mouse monoclonal to Smad3
Anti-Smad4 (2G4)
YF-MA14071 100 ug
EUR 363
Description: Mouse monoclonal to Smad4
Anti-MGAT1 (2G4)
YF-MA14238 200 ul
EUR 363
Description: Mouse monoclonal to MGAT1
Anti-MGAT3 (2G4)
YF-MA14239 100 ug
EUR 363
Description: Mouse monoclonal to MGAT3
Anti-iNOS (2G4)
YF-MA14483 100 ug
EUR 363
Description: Mouse monoclonal to iNOS
Anti-OIF (2G4)
YF-MA14555 100 ug
EUR 363
Description: Mouse monoclonal to OIF
Anti-Eif3a (2G4)
YF-MA16469 100 ug
EUR 363
Description: Mouse monoclonal to Eif3a
Anti-FGFR1OP2 (2G4)
YF-MA18056 100 ug
EUR 363
Description: Mouse monoclonal to FGFR1OP2
Anti-TROY (2G4)
YF-MA18786 100 ug
EUR 363
Description: Mouse monoclonal to TROY
Anti-DHX32 (2G4)
YF-MA18828 100 ug
EUR 363
Description: Mouse monoclonal to DHX32
Anti-CFC1 (2G4)
YF-MA18907 100 ug
EUR 363
Description: Mouse monoclonal to CFC1
Anti-CRMP5 (2G4)
YF-MA18983 100 ug
EUR 363
Description: Mouse monoclonal to CRMP5
Anti-C13orf1 (2G4)
YF-MA19038 100 ug
EUR 363
Description: Mouse monoclonal to C13orf1
Anti-CPNE5 (2G4)
YF-MA19095 50 ug
EUR 363
Description: Mouse monoclonal to CPNE5
Anti-CPNE5 (2G4)
YF-MA19096 200 ul
EUR 363
Description: Mouse monoclonal to CPNE5
Anti-BOULE (2G4)
YF-MA19291 100 ug
EUR 363
Description: Mouse monoclonal to BOULE
Anti-ZSWIM2 (2G4)
YF-MA19939 100 ug
EUR 363
Description: Mouse monoclonal to ZSWIM2
Anti-PFDN4 (2G4)
YF-MA20386 100 ug
EUR 363
Description: Mouse monoclonal to PFDN4
Human A Proliferation inducing ligand ELISA kit
E01A0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human A Proliferation inducing ligand ELISA kit
E01A0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human MKI67/ Proliferation marker protein Ki-67 ELISA Kit
E1597Hu 1 Kit
EUR 563
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
PA2G4 Rabbit pAb
A14037-100ul 100 ul
EUR 308
PA2G4 Rabbit pAb
A14037-200ul 200 ul
EUR 459
PA2G4 Rabbit pAb
A14037-20ul 20 ul
EUR 183
PA2G4 Rabbit pAb
A14037-50ul 50 ul
EUR 223
PA2G4 Blocking Peptide
33R-5182 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 70R-8718
PA2G4 Blocking Peptide
33R-6656 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 20R-1262
Pa2g4 Blocking Peptide
33R-7021 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pa2g4 antibody, catalog no. 70R-9556
PA2G4 cloning plasmid
CSB-CL891987HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgtcgggcgaggacgagcaacaggagcaaactatcgctgaggacctggtcgtgaccaagtataagatggggggcgacatcgccaacagggtacttcggtccttggtggaagcatctagctcaggtgtgtcggtactgagcctgtgtgagaaaggtgatgccatgattatggaag
  • Show more
Description: A cloning plasmid for the PA2G4 gene.
PA2G4 Blocking Peptide
DF4825-BP 1mg
EUR 195
PA2G4 Blocking Peptide
DF7311-BP 1mg
EUR 195
PA2G4 Conjugated Antibody
C32814 100ul
EUR 397