Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit

Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit

To Order Contact us now: 

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
RD-PA2G4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Proliferation Associated Protein 2G4 (PA2G4)ELISA kit
201-12-2522	SunredBio	96 tests	EUR 440
This Proliferation Associated Protein 2G4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
20-abx152617	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Proliferation-associated protein 2G4 (PA2G4) ELISA Kit
abx251224-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human PA2G4/ Proliferation-associated protein 2G4 ELISA Kit
E1856Hu	Sunlong	1 Kit	EUR 571

Human PA2G4(Proliferation-associated protein 2G4) ELISA Kit
EH1906	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q9UQ80 Alias: PA2G4(Proliferation Associated Protein 2G4)/EBP1/HG4-1/Cell cycle protein p38-2G4 homolog/ErbB-3 binding protein 1/ErbB3-binding protein 1/ErbB3-binding protein Ebp1/p38-2G4/proliferation-asso Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Proliferation- associated protein 2G4, PA2G4 ELISA KIT
ELI-05624h	Lifescience Market	96 Tests	EUR 824

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx351485-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Proliferation Associated Protein 2G4(PA2G4)ELISA Kit
QY-E00297	Qayee Biotechnology	96T	EUR 361

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
SEL980Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.

Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
4-SEL980Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Proliferation Associated Protein 2G4 elisa. Alternative names of the recognized antigen: EBP1 HG4-1 p38-2G4 Cell cycle protein p38-2G4 homolog ErbB3-binding protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx004117	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx129266	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx174187	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236092-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236093-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Proliferation Associated Protein 2G4 (PA2G4) Antibody
abx236094-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx325583	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Proliferation Associated Protein 2G4 (PA2G4) Antibody
20-abx302879	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Proliferation Associated Protein 2G4 (PA2G4)
4-RPL980Hu01	Cloud-Clone	EUR 483.49 EUR 232.00 EUR 1538.08 EUR 579.36 EUR 1058.72 EUR 386.00 EUR 3695.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UQ80 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 47.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Proliferation Associated Protein 2G4 expressed in: E.coli

Human Proliferation Associated Protein 2G4 (PA2G4) Protein
20-abx166114	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Pa2g4/ Proliferation-associated protein 2G4 ELISA Kit
E1094Mo	Sunlong	1 Kit	EUR 571

Mouse Proliferation- associated protein 2G4, Pa2g4 ELISA KIT
ELI-05623m	Lifescience Market	96 Tests	EUR 865

Monkey Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx359300-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx361100-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx362974-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
abx356055-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Proliferation-associated protein 2G4 (PA2G4) ELISA Kit
abx518287-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat ProlifeRation Associated Protein 2G4(PA2G4)ELISA kit
QY-E10521	Qayee Biotechnology	96T	EUR 361

Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit
abx197559-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit
20-abx496007	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
E-EL-H0868	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PA2G4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
ELK6144	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Proliferation Associated Protein 2G4 (PA2G4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s Show more
Description: A sandwich ELISA kit for detection of Proliferation Associated Protein 2G4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-48T	Abbkine	48T	EUR 332
PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
KTE61323-96T	Abbkine	96T	EUR 539
PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces Show more
Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Proliferation Associated Protein 2G4 (PA2G4) Antibody (HRP)
20-abx312242	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Proliferation Associated Protein 2G4 (PA2G4) Antibody (FITC)
20-abx312243	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Proliferation Associated Protein 2G4 (PA2G4) Antibody (Biotin)
20-abx312244	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PA2G4 Proliferation-associated protein 2G4 Human Recombinant Protein
PROTQ9UQ80	BosterBio	Regular: 25ug	EUR 317
Description: PA2G4 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 402 amino acids (1-394 a.a.) and having a molecular mass of 44.8kDa._x000D_ PA2G4 is fused to 8 amino acids His Tag at C-terminus and purified by proprietary chromatographic techniques._x000D_

Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human)
4-PAL980Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PA2G4 (Ser2~Asp394) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4)

CLIA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
E-CL-H0601	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's PA2G4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant

Proliferation-Associated 2G4, 38 kDa (PA2G4) Antibody
20-abx114707	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC
4-PAL980Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PA2G4 (Ser2~Asp394) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC.

Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Biotinylated
4-PAL980Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PA2G4 (Ser2~Asp394) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Biotin.

Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Cy3
4-PAL980Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PA2G4 (Ser2~Asp394) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Cy3.

Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), FITC
4-PAL980Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PA2G4 (Ser2~Asp394) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with FITC.

Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), HRP
4-PAL980Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PA2G4 (Ser2~Asp394) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with HRP.

Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), PE
4-PAL980Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PA2G4 (Ser2~Asp394) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with PE.

Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC-Cy7
4-PAL980Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PA2G4 (Ser2~Asp394) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC-Cy7.

Proliferation-associated protein 2G4 Protein
20-abx260573	Abbexa	EUR 2861.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

Recombinant Human Proliferation-associated protein 2G4
7-05794	CHI Scientific	5µg	Ask for price

Recombinant Human Proliferation-associated protein 2G4
7-05795	CHI Scientific	25µg	Ask for price

Recombinant Human Proliferation-associated protein 2G4
7-05796	CHI Scientific	1mg	Ask for price

Mouse ProlifeMouseion Associated Protein 2G4(PA2G4)ELISA kit
QY-E21239	Qayee Biotechnology	96T	EUR 361

Human PA2G4 ELISA Kit
ELA-E1733h	Lifescience Market	96 Tests	EUR 824

PA2G4 ELISA KIT|Human
EF006020	Lifescience Market	96 Tests	EUR 689

Human Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit
abx383208-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PA2G4 ELISA Kit (Human) (OKCD09346)
OKCD09346	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: PA2G4 is an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL

PA2G4 ELISA Kit (Human) (OKEH04697)
OKEH04697	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL

Mouse Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit
abx390568-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PA2G4 Recombinant Protein (Human)
RP022390	ABM	100 ug	Ask for price

Human Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx251699-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human SIPA1L1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit
EH2343	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O43166 Alias: SIPA1L1/High-risk human papilloma viruses E6 oncoproteins targeted protein 1(E6-targeted protein 1)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

ELISA kit for Human Signal-induced proliferation-associated 1-like protein 1
EK4726	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SIPA1L1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E2290Hu	Sunlong	1 Kit	EUR 605

Signal-Induced Proliferation-Associated 1 Antibody
20-abx115563	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
20-abx008008	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025158-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025158-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025159-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx025159-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx211049	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
20-abx123090	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
20-abx126551	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx031502-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
abx031502-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx029202-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx029202-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
abx237872-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx339802	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
20-abx338441	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
abx231714-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Rat Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx256646-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Rat Signal-induced proliferation-associated 1-like protein 1
EK4727	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E0891Ra	Sunlong	1 Kit	EUR 646

Mouse Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
E1349Mo	Sunlong	1 Kit	EUR 632

Mouse Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
abx520596-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Sipa1l1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit
ER0671	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O35412 Alias: Sipa1l1/SPA-1-like protein p1294/Spine-associated Rap GTPase-activating protein(SPAR)/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Monoclonal SLC13A5 Antibody (clone 2G4), Clone: 2G4
APR09978G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human SLC13A5 (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E

PA2G4 antibody
20R-1262	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal PA2G4 antibody

PA2G4 antibody
70R-19083	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PA2G4 antibody

PA2G4 Antibody
32814-100ul	SAB	100ul	EUR 252

PA2G4 antibody
10R-1280	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal PA2G4 antibody

PA2G4 Antibody
1-CSB-PA891987LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PA2G4 Antibody
DF4825	Affbiotech	200ul	EUR 304
Description: PA2G4 Antibody detects endogenous levels of total PA2G4.

PA2G4 Antibody
DF7311	Affbiotech	200ul	EUR 304
Description: PA2G4 Antibody detects endogenous levels of total PA2G4.

PA2G4 Antibody
1-CSB-PA017344GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen affinity purified
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PA2G4 antibody
70R-8718	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal PA2G4 antibody

Pa2g4 antibody
70R-9556	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Pa2g4 antibody

PA2G4 Antibody
1-CSB-PA020199	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

PA2G4 siRNA
20-abx927569	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PA2G4 siRNA
20-abx927570	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PA2G4 Antibody
ABD4825	Lifescience Market	100 ug	EUR 438

PA2G4 Antibody
ABD7311	Lifescience Market	100 ug	EUR 438

PA2G4 protein (His tag)
80R-1311	Fitzgerald	100 ug	EUR 268
Description: Purified recombinant Human PA2G4 protein

PA2G4 Recombinant Protein (Mouse)
RP159827	ABM	100 ug	Ask for price

PA2G4 Recombinant Protein (Rat)
RP219104	ABM	100 ug	Ask for price

Human PA2G4 shRNA Plasmid
20-abx953348	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Monoclonal NOS2 / iNOS Antibody (clone 2G4), Clone: 2G4
APR08771G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human NOS2 / iNOS (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E

Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (HRP)
20-abx337700	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (FITC)
20-abx337701	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (Biotin)
20-abx337702	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

anti-NBL1 (2G4)
LF-MA10205	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NBL1

anti-CHD3 (2G4)
LF-MA30407	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to CHD3

Anti-MTAP (2G4)
YF-MA10588	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MTAP

Anti-SLC13A5 (2G4)
YF-MA11777	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SLC13A5

Anti-ALDH3A1 (2G4)
YF-MA11891	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ALDH3A1

Anti-TRIM23 (2G4)
YF-MA11982	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRIM23

Anti-RCBTB2 (2G4)
YF-MA12429	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RCBTB2

Anti-LAIR1 (2G4)
YF-MA13950	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to LAIR1

Anti-Smad3 (2G4)
YF-MA14062	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Smad3

Anti-Smad4 (2G4)
YF-MA14071	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Smad4

Anti-MGAT1 (2G4)
YF-MA14238	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to MGAT1

Anti-MGAT3 (2G4)
YF-MA14239	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MGAT3

Anti-iNOS (2G4)
YF-MA14483	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to iNOS

Anti-OIF (2G4)
YF-MA14555	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OIF

Anti-Eif3a (2G4)
YF-MA16469	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Eif3a

Anti-FGFR1OP2 (2G4)
YF-MA18056	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FGFR1OP2

Anti-TROY (2G4)
YF-MA18786	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TROY

Anti-DHX32 (2G4)
YF-MA18828	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DHX32

Anti-CFC1 (2G4)
YF-MA18907	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CFC1

Anti-CRMP5 (2G4)
YF-MA18983	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CRMP5

Anti-C13orf1 (2G4)
YF-MA19038	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to C13orf1

Anti-CPNE5 (2G4)
YF-MA19095	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to CPNE5

Anti-CPNE5 (2G4)
YF-MA19096	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to CPNE5

Anti-BOULE (2G4)
YF-MA19291	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to BOULE

Anti-ZSWIM2 (2G4)
YF-MA19939	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ZSWIM2

Anti-PFDN4 (2G4)
YF-MA20386	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PFDN4

Human A Proliferation inducing ligand ELISA kit
E01A0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A Proliferation inducing ligand ELISA kit
E01A0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MKI67/ Proliferation marker protein Ki-67 ELISA Kit
E1597Hu	Sunlong	1 Kit	EUR 563

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

PA2G4 Rabbit pAb
A14037-100ul	Abclonal	100 ul	EUR 308

PA2G4 Rabbit pAb
A14037-200ul	Abclonal	200 ul	EUR 459

PA2G4 Rabbit pAb
A14037-20ul	Abclonal	20 ul	EUR 183

PA2G4 Rabbit pAb
A14037-50ul	Abclonal	50 ul	EUR 223

PA2G4 Blocking Peptide
33R-5182	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 70R-8718

PA2G4 Blocking Peptide
33R-6656	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 20R-1262

Pa2g4 Blocking Peptide
33R-7021	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pa2g4 antibody, catalog no. 70R-9556

PA2G4 cloning plasmid
CSB-CL891987HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1185 Sequence: atgtcgggcgaggacgagcaacaggagcaaactatcgctgaggacctggtcgtgaccaagtataagatggggggcgacatcgccaacagggtacttcggtccttggtggaagcatctagctcaggtgtgtcggtactgagcctgtgtgagaaaggtgatgccatgattatggaag Show more
Description: A cloning plasmid for the PA2G4 gene.

PA2G4 Blocking Peptide
DF4825-BP	Affbiotech	1mg	EUR 195

PA2G4 Blocking Peptide
DF7311-BP	Affbiotech	1mg	EUR 195

PA2G4 Conjugated Antibody
C32814	SAB	100ul	EUR 397