Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit

Human PA2G4(Proliferation Associated Protein 2G4) ELISA Kit

To Order Contact us now: 

    Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    RD-PA2G4-Hu-96Tests 96 Tests
    EUR 783
    Human Proliferation Associated Protein 2G4 (PA2G4)ELISA kit
    201-12-2522 96 tests
    EUR 440
    • This Proliferation Associated Protein 2G4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    20-abx152617
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Proliferation-associated protein 2G4 (PA2G4) ELISA Kit
    abx251224-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human PA2G4/ Proliferation-associated protein 2G4 ELISA Kit
    E1856Hu 1 Kit
    EUR 571
    Human PA2G4(Proliferation-associated protein 2G4) ELISA Kit
    EH1906 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q9UQ80
    • Alias: PA2G4(Proliferation Associated Protein 2G4)/EBP1/HG4-1/Cell cycle protein p38-2G4 homolog/ErbB-3 binding protein 1/ErbB3-binding protein 1/ErbB3-binding protein Ebp1/p38-2G4/proliferation-asso
    • Show more
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
    Human Proliferation- associated protein 2G4, PA2G4 ELISA KIT
    ELI-05624h 96 Tests
    EUR 824
    Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    abx351485-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.
    Human Proliferation Associated Protein 2G4(PA2G4)ELISA Kit
    QY-E00297 96T
    EUR 361
    Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    SEL980Hu-10x96wellstestplate 10x96-wells test plate
    EUR 5189.65
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inte
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
    Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    SEL980Hu-1x48wellstestplate 1x48-wells test plate
    EUR 515.03
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inte
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
    Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    SEL980Hu-1x96wellstestplate 1x96-wells test plate
    EUR 692.9
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inte
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
    Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    SEL980Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2818.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proliferation Associated Protein 2G4 (PA2G4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inte
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in tissue homogenates, cell lysates and other biological fluids.
    Human Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    4-SEL980Hu
    • EUR 5240.00
    • EUR 2769.00
    • EUR 693.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Proliferation Associated Protein 2G4 elisa. Alternative names of the recognized antigen: EBP1
    • HG4-1
    • p38-2G4
    • Cell cycle protein p38-2G4 homolog
    • ErbB3-binding protein 1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Proliferation Associated Protein 2G4 (PA2G4) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody
    20-abx004117
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody
    20-abx129266
    • EUR 453.00
    • EUR 133.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody
    20-abx174187
    • EUR 926.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody
    abx236092-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody
    abx236093-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody
    abx236094-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody
    20-abx325583
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody
    20-abx302879
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Recombinant Proliferation Associated Protein 2G4 (PA2G4)
    4-RPL980Hu01
    • EUR 483.49
    • EUR 232.00
    • EUR 1538.08
    • EUR 579.36
    • EUR 1058.72
    • EUR 386.00
    • EUR 3695.20
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9UQ80
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 47.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Proliferation Associated Protein 2G4 expressed in: E.coli
    Human Proliferation Associated Protein 2G4 (PA2G4) Protein
    20-abx166114
    • EUR 676.00
    • EUR 272.00
    • EUR 2068.00
    • EUR 801.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Mouse Pa2g4/ Proliferation-associated protein 2G4 ELISA Kit
    E1094Mo 1 Kit
    EUR 571
    Mouse Proliferation- associated protein 2G4, Pa2g4 ELISA KIT
    ELI-05623m 96 Tests
    EUR 865
    Monkey Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    abx359300-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Pig Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    abx361100-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Rabbit Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    abx362974-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Chicken Proliferation Associated Protein 2G4 (PA2G4) ELISA Kit
    abx356055-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Mouse Proliferation-associated protein 2G4 (PA2G4) ELISA Kit
    abx518287-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Rat ProlifeRation Associated Protein 2G4(PA2G4)ELISA kit
    QY-E10521 96T
    EUR 361
    Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit
    abx197559-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Human Proliferation Associated Protein 2G4 (PA2G4) CLIA Kit
    20-abx496007
    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
    E-EL-H0868 1 plate of 96 wells
    EUR 534
    • Gentaur's PA2G4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
    ELK6144 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Proliferation Associated Protein 2G4 (PA2G4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
    • Show more
    Description: A sandwich ELISA kit for detection of Proliferation Associated Protein 2G4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
    KTE61323-48T 48T
    EUR 332
    • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
    KTE61323-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Proliferation-associated protein 2G4 (PA2G4)
    KTE61323-96T 96T
    EUR 539
    • PA2G4 encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA proces
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Proliferation-associated protein 2G4 (PA2G4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody (HRP)
    20-abx312242
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody (FITC)
    20-abx312243
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Antibody (Biotin)
    20-abx312244
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    PA2G4 Proliferation-associated protein 2G4 Human Recombinant Protein
    PROTQ9UQ80 Regular: 25ug
    EUR 317
    Description: PA2G4 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 402 amino acids (1-394 a.a.) and having a molecular mass of 44.8kDa._x000D_ PA2G4 is fused to 8 amino acids His Tag at C-terminus and purified by proprietary chromatographic techniques._x000D_
    Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human)
    4-PAL980Hu01
    • EUR 262.00
    • EUR 2747.00
    • EUR 679.00
    • EUR 331.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4)
    CLIA kit for Human PA2G4 (Proliferation Associated Protein 2G4)
    E-CL-H0601 1 plate of 96 wells
    EUR 584
    • Gentaur's PA2G4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PA2G4 . Standards or samples are added to the micro CLIA plate wells and combined with th
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Human PA2G4 (Proliferation Associated Protein 2G4) in samples from Serum, Plasma, Cell supernatant
    Proliferation-Associated 2G4, 38 kDa (PA2G4) Antibody
    20-abx114707
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC
    4-PAL980Hu01-APC
    • EUR 368.00
    • EUR 3599.00
    • EUR 993.00
    • EUR 472.00
    • EUR 229.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC.
    Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Biotinylated
    4-PAL980Hu01-Biotin
    • EUR 328.00
    • EUR 2697.00
    • EUR 786.00
    • EUR 404.00
    • EUR 226.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Biotin.
    Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), Cy3
    4-PAL980Hu01-Cy3
    • EUR 449.00
    • EUR 4757.00
    • EUR 1283.00
    • EUR 588.00
    • EUR 264.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with Cy3.
    Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), FITC
    4-PAL980Hu01-FITC
    • EUR 314.00
    • EUR 2899.00
    • EUR 814.00
    • EUR 397.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with FITC.
    Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), HRP
    4-PAL980Hu01-HRP
    • EUR 335.00
    • EUR 3135.00
    • EUR 877.00
    • EUR 426.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with HRP.
    Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), PE
    4-PAL980Hu01-PE
    • EUR 314.00
    • EUR 2899.00
    • EUR 814.00
    • EUR 397.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with PE.
    Proliferation Associated Protein 2G4 (PA2G4) Polyclonal Antibody (Human), APC-Cy7
    4-PAL980Hu01-APC-Cy7
    • EUR 616.00
    • EUR 7078.00
    • EUR 1867.00
    • EUR 824.00
    • EUR 338.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PA2G4 (Ser2~Asp394)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Proliferation Associated Protein 2G4 (PA2G4). This antibody is labeled with APC-Cy7.
    Proliferation-associated protein 2G4 Protein
    20-abx260573
    • EUR 2861.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 25 ug
    • 5 ug
    • Shipped within 5-10 working days.
    Recombinant Human Proliferation-associated protein 2G4
    7-05794 5µg Ask for price
    Recombinant Human Proliferation-associated protein 2G4
    7-05795 25µg Ask for price
    Recombinant Human Proliferation-associated protein 2G4
    7-05796 1mg Ask for price
    Mouse ProlifeMouseion Associated Protein 2G4(PA2G4)ELISA kit
    QY-E21239 96T
    EUR 361
    Human PA2G4 ELISA Kit
    ELA-E1733h 96 Tests
    EUR 824
    PA2G4 ELISA KIT|Human
    EF006020 96 Tests
    EUR 689
    Human Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit
    abx383208-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    PA2G4 ELISA Kit (Human) (OKCD09346)
    OKCD09346 96 Wells
    EUR 909
    Description: Description of target: PA2G4 is an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL
    PA2G4 ELISA Kit (Human) (OKEH04697)
    OKEH04697 96 Wells
    EUR 662
    Description: Description of target: This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL
    Mouse Signal-induced proliferation-associated protein 1 (SIPA1) ELISA Kit
    abx390568-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    PA2G4 Recombinant Protein (Human)
    RP022390 100 ug Ask for price
    Human Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
    abx251699-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human SIPA1L1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit
    EH2343 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: O43166
    • Alias: SIPA1L1/High-risk human papilloma viruses E6 oncoproteins targeted protein 1(E6-targeted protein 1)
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    ELISA kit for Human Signal-induced proliferation-associated 1-like protein 1
    EK4726 96 tests
    EUR 603
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    Human SIPA1L1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
    E2290Hu 1 Kit
    EUR 605
    Signal-Induced Proliferation-Associated 1 Antibody
    20-abx115563
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
    20-abx008008
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
    abx025158-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
    abx025158-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
    abx025159-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
    abx025159-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
    20-abx211049
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
    20-abx123090
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.
    Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
    20-abx126551
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
    abx031502-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Restricted Expression Proliferation-Associated Protein 100 (P100) Antibody
    abx031502-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
    abx029202-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
    abx029202-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Signal-Induced Proliferation-Associated Protein 1 (SIPA1) Antibody
    abx237872-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
    20-abx339802
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Signal-induced proliferation-associated protein 1 (SIPA1) Antibody
    20-abx338441
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Proliferation-Associated Cytokine-Inducible Protein CIP29 (CIP29) Antibody
    abx231714-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Rat Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
    abx256646-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    ELISA kit for Rat Signal-induced proliferation-associated 1-like protein 1
    EK4727 96 tests
    EUR 603
    Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Signal-induced proliferation-associated 1-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    Rat Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
    E0891Ra 1 Kit
    EUR 646
    Mouse Sipa1l1/ Signal-induced proliferation-associated 1-like protein 1 ELISA Kit
    E1349Mo 1 Kit
    EUR 632
    Mouse Signal-induced proliferation-associated 1-like protein 1 (SIPA1L1) ELISA Kit
    abx520596-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Rat Sipa1l1(Signal-induced proliferation-associated 1-like protein 1) ELISA Kit
    ER0671 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: O35412
    • Alias: Sipa1l1/SPA-1-like protein p1294/Spine-associated Rap GTPase-activating protein(SPAR)/
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml
    Monoclonal SLC13A5 Antibody (clone 2G4), Clone: 2G4
    APR09978G 0.05mg
    EUR 528
    Description: A Monoclonal antibody against Human SLC13A5 (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E
    PA2G4 antibody
    20R-1262 100 ug
    EUR 377
    Description: Rabbit polyclonal PA2G4 antibody
    PA2G4 antibody
    70R-19083 50 ul
    EUR 435
    Description: Rabbit polyclonal PA2G4 antibody
    PA2G4 Antibody
    32814-100ul 100ul
    EUR 252
    PA2G4 antibody
    10R-1280 100 ug
    EUR 512
    Description: Mouse monoclonal PA2G4 antibody
    PA2G4 Antibody
    1-CSB-PA891987LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
    PA2G4 Antibody
    DF4825 200ul
    EUR 304
    Description: PA2G4 Antibody detects endogenous levels of total PA2G4.
    PA2G4 Antibody
    DF7311 200ul
    EUR 304
    Description: PA2G4 Antibody detects endogenous levels of total PA2G4.
    PA2G4 Antibody
    1-CSB-PA017344GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen affinity purified
    Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    PA2G4 antibody
    70R-8718 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal PA2G4 antibody
    Pa2g4 antibody
    70R-9556 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal Pa2g4 antibody
    PA2G4 Antibody
    1-CSB-PA020199
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against PA2G4. Recognizes PA2G4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
    PA2G4 siRNA
    20-abx927569
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PA2G4 siRNA
    20-abx927570
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PA2G4 Antibody
    ABD4825 100 ug
    EUR 438
    PA2G4 Antibody
    ABD7311 100 ug
    EUR 438
    PA2G4 protein (His tag)
    80R-1311 100 ug
    EUR 268
    Description: Purified recombinant Human PA2G4 protein
    PA2G4 Recombinant Protein (Mouse)
    RP159827 100 ug Ask for price
    PA2G4 Recombinant Protein (Rat)
    RP219104 100 ug Ask for price
    Human PA2G4 shRNA Plasmid
    20-abx953348
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Monoclonal NOS2 / iNOS Antibody (clone 2G4), Clone: 2G4
    APR08771G 0.05mg
    EUR 528
    Description: A Monoclonal antibody against Human NOS2 / iNOS (clone 2G4). The antibodies are raised in Mouse and are from clone 2G4. This antibody is applicable in WB and IHC-P, E
    Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (HRP)
    20-abx337700
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (FITC)
    20-abx337701
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Signal-induced proliferation-associated protein 1 (SIPA1) Antibody (Biotin)
    20-abx337702
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    anti-NBL1 (2G4)
    LF-MA10205 100 ug
    EUR 363
    Description: Mouse monoclonal to NBL1
    anti-CHD3 (2G4)
    LF-MA30407 100 ul
    EUR 486
    Description: Mouse Monoclonal to CHD3
    Anti-MTAP (2G4)
    YF-MA10588 100 ug
    EUR 363
    Description: Mouse monoclonal to MTAP
    Anti-SLC13A5 (2G4)
    YF-MA11777 100 ug
    EUR 363
    Description: Mouse monoclonal to SLC13A5
    Anti-ALDH3A1 (2G4)
    YF-MA11891 100 ug
    EUR 363
    Description: Mouse monoclonal to ALDH3A1
    Anti-TRIM23 (2G4)
    YF-MA11982 100 ug
    EUR 363
    Description: Mouse monoclonal to TRIM23
    Anti-RCBTB2 (2G4)
    YF-MA12429 100 ug
    EUR 363
    Description: Mouse monoclonal to RCBTB2
    Anti-LAIR1 (2G4)
    YF-MA13950 100 ug
    EUR 363
    Description: Mouse monoclonal to LAIR1
    Anti-Smad3 (2G4)
    YF-MA14062 100 ug
    EUR 363
    Description: Mouse monoclonal to Smad3
    Anti-Smad4 (2G4)
    YF-MA14071 100 ug
    EUR 363
    Description: Mouse monoclonal to Smad4
    Anti-MGAT1 (2G4)
    YF-MA14238 200 ul
    EUR 363
    Description: Mouse monoclonal to MGAT1
    Anti-MGAT3 (2G4)
    YF-MA14239 100 ug
    EUR 363
    Description: Mouse monoclonal to MGAT3
    Anti-iNOS (2G4)
    YF-MA14483 100 ug
    EUR 363
    Description: Mouse monoclonal to iNOS
    Anti-OIF (2G4)
    YF-MA14555 100 ug
    EUR 363
    Description: Mouse monoclonal to OIF
    Anti-Eif3a (2G4)
    YF-MA16469 100 ug
    EUR 363
    Description: Mouse monoclonal to Eif3a
    Anti-FGFR1OP2 (2G4)
    YF-MA18056 100 ug
    EUR 363
    Description: Mouse monoclonal to FGFR1OP2
    Anti-TROY (2G4)
    YF-MA18786 100 ug
    EUR 363
    Description: Mouse monoclonal to TROY
    Anti-DHX32 (2G4)
    YF-MA18828 100 ug
    EUR 363
    Description: Mouse monoclonal to DHX32
    Anti-CFC1 (2G4)
    YF-MA18907 100 ug
    EUR 363
    Description: Mouse monoclonal to CFC1
    Anti-CRMP5 (2G4)
    YF-MA18983 100 ug
    EUR 363
    Description: Mouse monoclonal to CRMP5
    Anti-C13orf1 (2G4)
    YF-MA19038 100 ug
    EUR 363
    Description: Mouse monoclonal to C13orf1
    Anti-CPNE5 (2G4)
    YF-MA19095 50 ug
    EUR 363
    Description: Mouse monoclonal to CPNE5
    Anti-CPNE5 (2G4)
    YF-MA19096 200 ul
    EUR 363
    Description: Mouse monoclonal to CPNE5
    Anti-BOULE (2G4)
    YF-MA19291 100 ug
    EUR 363
    Description: Mouse monoclonal to BOULE
    Anti-ZSWIM2 (2G4)
    YF-MA19939 100 ug
    EUR 363
    Description: Mouse monoclonal to ZSWIM2
    Anti-PFDN4 (2G4)
    YF-MA20386 100 ug
    EUR 363
    Description: Mouse monoclonal to PFDN4
    Human A Proliferation inducing ligand ELISA kit
    E01A0051-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human A Proliferation inducing ligand ELISA kit
    E01A0051-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human A Proliferation inducing ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human MKI67/ Proliferation marker protein Ki-67 ELISA Kit
    E1597Hu 1 Kit
    EUR 563
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    PA2G4 Rabbit pAb
    A14037-100ul 100 ul
    EUR 308
    PA2G4 Rabbit pAb
    A14037-200ul 200 ul
    EUR 459
    PA2G4 Rabbit pAb
    A14037-20ul 20 ul
    EUR 183
    PA2G4 Rabbit pAb
    A14037-50ul 50 ul
    EUR 223
    PA2G4 Blocking Peptide
    33R-5182 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 70R-8718
    PA2G4 Blocking Peptide
    33R-6656 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PA2G4 antibody, catalog no. 20R-1262
    Pa2g4 Blocking Peptide
    33R-7021 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pa2g4 antibody, catalog no. 70R-9556
    PA2G4 cloning plasmid
    CSB-CL891987HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1185
    • Sequence: atgtcgggcgaggacgagcaacaggagcaaactatcgctgaggacctggtcgtgaccaagtataagatggggggcgacatcgccaacagggtacttcggtccttggtggaagcatctagctcaggtgtgtcggtactgagcctgtgtgagaaaggtgatgccatgattatggaag
    • Show more
    Description: A cloning plasmid for the PA2G4 gene.
    PA2G4 Blocking Peptide
    DF4825-BP 1mg
    EUR 195
    PA2G4 Blocking Peptide
    DF7311-BP 1mg
    EUR 195
    PA2G4 Conjugated Antibody
    C32814 100ul
    EUR 397